Incidental Mutation 'R6268:Slc5a5'
ID507158
Institutional Source Beutler Lab
Gene Symbol Slc5a5
Ensembl Gene ENSMUSG00000000792
Gene Namesolute carrier family 5 (sodium iodide symporter), member 5
SynonymsNIS
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6268 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70882889-70892757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70888620 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 358 (S358R)
Ref Sequence ENSEMBL: ENSMUSP00000000809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000809]
Predicted Effect probably damaging
Transcript: ENSMUST00000000809
AA Change: S358R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000809
Gene: ENSMUSG00000000792
AA Change: S358R

DomainStartEndE-ValueType
Pfam:SSF 47 452 2.5e-43 PFAM
transmembrane domain 522 544 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium glucose cotransporter family. The encoded protein is responsible for the uptake of iodine in tissues such as the thyroid and lactating breast tissue. The iodine taken up by the thyroid is incorporated into the metabolic regulators triiodothyronine (T3) and tetraiodothyronine (T4). Mutations in this gene are associated with thyroid dyshormonogenesis 1.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced T3 and T4 levels when fed a minimal iodine diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,540,408 I78T probably benign Het
Afg3l1 A T 8: 123,492,926 I398F probably damaging Het
Ahctf1 T C 1: 179,763,483 H1244R probably benign Het
Ank1 A T 8: 23,109,671 K797N probably damaging Het
Anxa6 G T 11: 54,987,077 probably null Het
Ap1b1 T A 11: 5,019,493 V310E probably damaging Het
C2cd2l T C 9: 44,317,666 I123V probably damaging Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Cfap54 T A 10: 93,038,909 I542F probably damaging Het
Cfap57 G T 4: 118,569,451 Y1100* probably null Het
Coq9 A G 8: 94,850,234 E158G probably benign Het
Cox15 A T 19: 43,739,926 W303R possibly damaging Het
Cpa5 A G 6: 30,615,173 Y103C probably damaging Het
Crygn A T 5: 24,756,191 V39E probably damaging Het
Csf1 G T 3: 107,747,157 S132R possibly damaging Het
Dapk1 G A 13: 60,761,766 V1398M possibly damaging Het
Degs2 C A 12: 108,692,580 V47L probably damaging Het
Dock5 C A 14: 67,790,275 E1057* probably null Het
Doxl2 T A 6: 48,977,682 Y585N probably benign Het
Dsg1b C A 18: 20,388,163 Q26K probably benign Het
Fam181a T C 12: 103,316,544 V236A possibly damaging Het
Fam78b C A 1: 167,078,553 P94T probably damaging Het
Fbxw25 T G 9: 109,654,650 T165P probably damaging Het
Flg C A 3: 93,288,175 probably benign Het
Frrs1 G T 3: 116,903,099 V573F probably damaging Het
Gm7298 A G 6: 121,779,073 T964A possibly damaging Het
Hoxd9 G T 2: 74,698,089 V12L probably damaging Het
Ikbkap T C 4: 56,762,305 Y1098C probably damaging Het
Kcnt1 A G 2: 25,903,597 probably null Het
Klhl3 G T 13: 58,013,842 R480S probably damaging Het
Klhl36 A G 8: 119,870,667 D369G probably damaging Het
Lama3 T A 18: 12,524,737 N303K probably damaging Het
Lhcgr T C 17: 88,742,704 T465A probably damaging Het
Llgl1 T C 11: 60,712,163 V888A probably benign Het
Lrp1b T A 2: 40,821,717 T3164S probably benign Het
Mmp3 T G 9: 7,447,622 D202E possibly damaging Het
Mocs1 C A 17: 49,435,155 T104K probably damaging Het
Mrpl42 A T 10: 95,496,707 probably null Het
Mtch2 T C 2: 90,863,648 C279R probably benign Het
Muc4 A T 16: 32,768,767 D2836V probably damaging Het
Myh7 T C 14: 54,989,284 E370G probably benign Het
Naa11 A G 5: 97,392,210 Y30H probably damaging Het
Ntng1 T C 3: 109,935,035 T141A probably damaging Het
Olfr1499 A T 19: 13,815,307 Y94* probably null Het
Olfr196 A C 16: 59,167,293 probably null Het
Olfr251 T C 9: 38,378,088 I69T probably benign Het
Pcdha12 G A 18: 37,022,424 C732Y possibly damaging Het
Plekhm2 G A 4: 141,632,341 Q392* probably null Het
Prr22 G A 17: 56,771,587 V247M probably damaging Het
Rapgef6 T A 11: 54,649,247 L716Q probably damaging Het
Rasgrp4 G A 7: 29,143,068 V246I probably damaging Het
Rhbdd2 C T 5: 135,643,260 T323I probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Scgb2b20 A T 7: 33,364,548 I99K possibly damaging Het
Scyl3 C T 1: 163,946,217 R324* probably null Het
Slc23a1 T C 18: 35,619,571 Y551C probably damaging Het
Sorcs3 T A 19: 48,790,166 N1007K probably damaging Het
Stxbp4 T A 11: 90,540,201 K428* probably null Het
Tmem63c T A 12: 87,081,953 I584N probably damaging Het
Traf3ip3 C T 1: 193,198,036 probably benign Het
Trgv2 G A 13: 19,336,831 T31I probably benign Het
Ttll3 C T 6: 113,392,563 R23C probably benign Het
Ugt2a3 A C 5: 87,329,613 L309R probably damaging Het
Urb1 A G 16: 90,753,919 M2015T probably benign Het
Vmn2r14 A C 5: 109,221,417 S97A possibly damaging Het
Vps13c C A 9: 67,951,449 T2727K probably benign Het
Xrn1 T A 9: 95,964,014 I40K probably damaging Het
Zc3h11a A G 1: 133,624,557 V604A probably benign Het
Zfp410 G A 12: 84,331,838 R259H probably benign Het
Zfp748 A G 13: 67,542,586 V185A possibly damaging Het
Other mutations in Slc5a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Slc5a5 APN 8 70888537 missense probably damaging 0.99
IGL01372:Slc5a5 APN 8 70890376 unclassified probably benign
IGL01394:Slc5a5 APN 8 70889388 nonsense probably null
IGL01571:Slc5a5 APN 8 70891332 unclassified probably benign
IGL02043:Slc5a5 APN 8 70892429 missense possibly damaging 0.84
IGL02186:Slc5a5 APN 8 70886120 missense possibly damaging 0.79
IGL02479:Slc5a5 APN 8 70888911 missense possibly damaging 0.67
IGL02559:Slc5a5 APN 8 70890271 missense probably damaging 1.00
IGL02892:Slc5a5 APN 8 70892517 missense probably damaging 1.00
IGL03388:Slc5a5 APN 8 70890328 missense probably benign 0.45
R0234:Slc5a5 UTSW 8 70889633 missense probably damaging 1.00
R0234:Slc5a5 UTSW 8 70889633 missense probably damaging 1.00
R0413:Slc5a5 UTSW 8 70891675 missense possibly damaging 0.63
R0662:Slc5a5 UTSW 8 70883875 missense probably benign 0.01
R0781:Slc5a5 UTSW 8 70890220 missense probably benign 0.19
R1061:Slc5a5 UTSW 8 70890221 missense probably benign 0.00
R1400:Slc5a5 UTSW 8 70889435 missense possibly damaging 0.87
R1524:Slc5a5 UTSW 8 70892334 missense probably damaging 1.00
R2033:Slc5a5 UTSW 8 70888587 missense probably damaging 0.99
R2072:Slc5a5 UTSW 8 70892439 missense possibly damaging 0.95
R2075:Slc5a5 UTSW 8 70892439 missense possibly damaging 0.95
R2110:Slc5a5 UTSW 8 70889751 intron probably null
R2111:Slc5a5 UTSW 8 70889751 intron probably null
R2112:Slc5a5 UTSW 8 70889751 intron probably null
R2201:Slc5a5 UTSW 8 70892458 missense probably damaging 0.98
R3978:Slc5a5 UTSW 8 70889395 missense probably benign 0.00
R4244:Slc5a5 UTSW 8 70890286 missense probably benign
R5161:Slc5a5 UTSW 8 70888848 missense probably damaging 1.00
R5397:Slc5a5 UTSW 8 70891179 missense probably damaging 1.00
R5718:Slc5a5 UTSW 8 70887755 missense probably benign 0.00
R5740:Slc5a5 UTSW 8 70888917 splice site probably null
R5869:Slc5a5 UTSW 8 70892330 missense probably damaging 1.00
R6290:Slc5a5 UTSW 8 70891178 missense probably damaging 1.00
R6292:Slc5a5 UTSW 8 70891178 missense probably damaging 1.00
R7098:Slc5a5 UTSW 8 70888538 missense probably damaging 0.99
R7354:Slc5a5 UTSW 8 70889603 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATAGATGAATGCTGTGGG -3'
(R):5'- TTTTGAGGATCTGCCCGGAG -3'

Sequencing Primer
(F):5'- GGGAGGGGTAGCTCAGTC -3'
(R):5'- TACAGTGGCACCCTCAGG -3'
Posted On2018-03-15