Incidental Mutation 'R6268:Stxbp4'
ID507174
Institutional Source Beutler Lab
Gene Symbol Stxbp4
Ensembl Gene ENSMUSG00000020546
Gene Namesyntaxin binding protein 4
SynonymsSynip, 6030470M02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6268 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location90476492-90638084 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 90540201 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 428 (K428*)
Ref Sequence ENSEMBL: ENSMUSP00000116191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020858] [ENSMUST00000143203]
Predicted Effect probably null
Transcript: ENSMUST00000020858
AA Change: K428*
SMART Domains Protein: ENSMUSP00000020858
Gene: ENSMUSG00000020546
AA Change: K428*

DomainStartEndE-ValueType
PDZ 29 109 6.13e-10 SMART
low complexity region 131 154 N/A INTRINSIC
coiled coil region 298 409 N/A INTRINSIC
low complexity region 504 522 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119669
Predicted Effect probably null
Transcript: ENSMUST00000123260
AA Change: K61*
SMART Domains Protein: ENSMUSP00000122365
Gene: ENSMUSG00000020546
AA Change: K61*

DomainStartEndE-ValueType
coiled coil region 3 42 N/A INTRINSIC
SCOP:d1i5hw_ 132 153 6e-7 SMART
Blast:WW 135 153 3e-7 BLAST
PDB:2YSG|A 136 153 4e-7 PDB
Predicted Effect probably null
Transcript: ENSMUST00000143203
AA Change: K428*
SMART Domains Protein: ENSMUSP00000116191
Gene: ENSMUSG00000020546
AA Change: K428*

DomainStartEndE-ValueType
PDZ 29 109 6.13e-10 SMART
low complexity region 131 154 N/A INTRINSIC
coiled coil region 298 409 N/A INTRINSIC
WW 501 533 1.11e-10 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,540,408 I78T probably benign Het
Afg3l1 A T 8: 123,492,926 I398F probably damaging Het
Ahctf1 T C 1: 179,763,483 H1244R probably benign Het
Ank1 A T 8: 23,109,671 K797N probably damaging Het
Anxa6 G T 11: 54,987,077 probably null Het
Ap1b1 T A 11: 5,019,493 V310E probably damaging Het
C2cd2l T C 9: 44,317,666 I123V probably damaging Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Cfap54 T A 10: 93,038,909 I542F probably damaging Het
Cfap57 G T 4: 118,569,451 Y1100* probably null Het
Coq9 A G 8: 94,850,234 E158G probably benign Het
Cox15 A T 19: 43,739,926 W303R possibly damaging Het
Cpa5 A G 6: 30,615,173 Y103C probably damaging Het
Crygn A T 5: 24,756,191 V39E probably damaging Het
Csf1 G T 3: 107,747,157 S132R possibly damaging Het
Dapk1 G A 13: 60,761,766 V1398M possibly damaging Het
Degs2 C A 12: 108,692,580 V47L probably damaging Het
Dock5 C A 14: 67,790,275 E1057* probably null Het
Doxl2 T A 6: 48,977,682 Y585N probably benign Het
Dsg1b C A 18: 20,388,163 Q26K probably benign Het
Fam181a T C 12: 103,316,544 V236A possibly damaging Het
Fam78b C A 1: 167,078,553 P94T probably damaging Het
Fbxw25 T G 9: 109,654,650 T165P probably damaging Het
Flg C A 3: 93,288,175 probably benign Het
Frrs1 G T 3: 116,903,099 V573F probably damaging Het
Gm7298 A G 6: 121,779,073 T964A possibly damaging Het
Hoxd9 G T 2: 74,698,089 V12L probably damaging Het
Ikbkap T C 4: 56,762,305 Y1098C probably damaging Het
Kcnt1 A G 2: 25,903,597 probably null Het
Klhl3 G T 13: 58,013,842 R480S probably damaging Het
Klhl36 A G 8: 119,870,667 D369G probably damaging Het
Lama3 T A 18: 12,524,737 N303K probably damaging Het
Lhcgr T C 17: 88,742,704 T465A probably damaging Het
Llgl1 T C 11: 60,712,163 V888A probably benign Het
Lrp1b T A 2: 40,821,717 T3164S probably benign Het
Mmp3 T G 9: 7,447,622 D202E possibly damaging Het
Mocs1 C A 17: 49,435,155 T104K probably damaging Het
Mrpl42 A T 10: 95,496,707 probably null Het
Mtch2 T C 2: 90,863,648 C279R probably benign Het
Muc4 A T 16: 32,768,767 D2836V probably damaging Het
Myh7 T C 14: 54,989,284 E370G probably benign Het
Naa11 A G 5: 97,392,210 Y30H probably damaging Het
Ntng1 T C 3: 109,935,035 T141A probably damaging Het
Olfr1499 A T 19: 13,815,307 Y94* probably null Het
Olfr196 A C 16: 59,167,293 probably null Het
Olfr251 T C 9: 38,378,088 I69T probably benign Het
Pcdha12 G A 18: 37,022,424 C732Y possibly damaging Het
Plekhm2 G A 4: 141,632,341 Q392* probably null Het
Prr22 G A 17: 56,771,587 V247M probably damaging Het
Rapgef6 T A 11: 54,649,247 L716Q probably damaging Het
Rasgrp4 G A 7: 29,143,068 V246I probably damaging Het
Rhbdd2 C T 5: 135,643,260 T323I probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Scgb2b20 A T 7: 33,364,548 I99K possibly damaging Het
Scyl3 C T 1: 163,946,217 R324* probably null Het
Slc23a1 T C 18: 35,619,571 Y551C probably damaging Het
Slc5a5 A T 8: 70,888,620 S358R probably damaging Het
Sorcs3 T A 19: 48,790,166 N1007K probably damaging Het
Tmem63c T A 12: 87,081,953 I584N probably damaging Het
Traf3ip3 C T 1: 193,198,036 probably benign Het
Trgv2 G A 13: 19,336,831 T31I probably benign Het
Ttll3 C T 6: 113,392,563 R23C probably benign Het
Ugt2a3 A C 5: 87,329,613 L309R probably damaging Het
Urb1 A G 16: 90,753,919 M2015T probably benign Het
Vmn2r14 A C 5: 109,221,417 S97A possibly damaging Het
Vps13c C A 9: 67,951,449 T2727K probably benign Het
Xrn1 T A 9: 95,964,014 I40K probably damaging Het
Zc3h11a A G 1: 133,624,557 V604A probably benign Het
Zfp410 G A 12: 84,331,838 R259H probably benign Het
Zfp748 A G 13: 67,542,586 V185A possibly damaging Het
Other mutations in Stxbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Stxbp4 APN 11 90535512 missense probably benign 0.00
IGL01312:Stxbp4 APN 11 90621649 splice site probably benign
IGL01313:Stxbp4 APN 11 90621649 splice site probably benign
IGL01314:Stxbp4 APN 11 90621649 splice site probably benign
IGL01316:Stxbp4 APN 11 90621649 splice site probably benign
IGL01377:Stxbp4 APN 11 90621649 splice site probably benign
IGL01380:Stxbp4 APN 11 90621649 splice site probably benign
IGL01385:Stxbp4 APN 11 90540248 missense possibly damaging 0.95
IGL01408:Stxbp4 APN 11 90621649 splice site probably benign
IGL02573:Stxbp4 APN 11 90540269 missense probably damaging 0.99
IGL02707:Stxbp4 APN 11 90537933 missense probably benign 0.00
IGL02809:Stxbp4 APN 11 90600184 critical splice donor site probably null
IGL02900:Stxbp4 APN 11 90607035 missense probably benign 0.03
IGL03177:Stxbp4 APN 11 90571753 missense probably benign 0.01
IGL03397:Stxbp4 APN 11 90540234 missense probably damaging 1.00
IGL02799:Stxbp4 UTSW 11 90494600 critical splice donor site probably null
IGL03134:Stxbp4 UTSW 11 90607184 missense probably damaging 0.98
R0005:Stxbp4 UTSW 11 90548917 missense possibly damaging 0.78
R0487:Stxbp4 UTSW 11 90592360 missense probably benign 0.00
R0930:Stxbp4 UTSW 11 90621700 start codon destroyed probably null 0.99
R1633:Stxbp4 UTSW 11 90540160 splice site probably benign
R3785:Stxbp4 UTSW 11 90535615 critical splice acceptor site probably null
R4359:Stxbp4 UTSW 11 90494644 nonsense probably null
R4591:Stxbp4 UTSW 11 90594780 missense probably benign 0.33
R4756:Stxbp4 UTSW 11 90607371 missense probably damaging 1.00
R5095:Stxbp4 UTSW 11 90548975 missense probably benign 0.00
R5870:Stxbp4 UTSW 11 90537956 missense possibly damaging 0.89
R6460:Stxbp4 UTSW 11 90606985 missense probably benign 0.35
R6479:Stxbp4 UTSW 11 90619187 missense probably damaging 0.99
R7139:Stxbp4 UTSW 11 90607009 nonsense probably null
R7349:Stxbp4 UTSW 11 90592111 splice site probably null
R7481:Stxbp4 UTSW 11 90594813 missense possibly damaging 0.94
R7812:Stxbp4 UTSW 11 90594828 missense probably damaging 1.00
R8903:Stxbp4 UTSW 11 90535441 missense unknown
V8831:Stxbp4 UTSW 11 90480671 missense probably benign 0.34
Z1176:Stxbp4 UTSW 11 90480671 missense probably benign 0.34
Z1177:Stxbp4 UTSW 11 90480671 missense probably benign 0.34
Z1177:Stxbp4 UTSW 11 90592331 critical splice donor site probably null
Z1177:Stxbp4 UTSW 11 90600146 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATCTGCACAGGTTCAGCATG -3'
(R):5'- TCTCCTCAAAATCAGAACCCATTTG -3'

Sequencing Primer
(F):5'- ACAGGTTCAGCATGGTCCTG -3'
(R):5'- TCAGAACCCATTTGTAAAAAGAGAG -3'
Posted On2018-03-15