Incidental Mutation 'R6269:Pgap1'
ID507197
Institutional Source Beutler Lab
Gene Symbol Pgap1
Ensembl Gene ENSMUSG00000073678
Gene Namepost-GPI attachment to proteins 1
SynonymsPGAP1, D230012E17Rik, oto, 5033403E17Rik, 9030223K07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.817) question?
Stock #R6269 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location54472994-54557684 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 54548008 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 136 (Y136*)
Ref Sequence ENSEMBL: ENSMUSP00000095346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097739]
Predicted Effect probably null
Transcript: ENSMUST00000097739
AA Change: Y136*
SMART Domains Protein: ENSMUSP00000095346
Gene: ENSMUSG00000073678
AA Change: Y136*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:PGAP1 82 302 7.2e-83 PFAM
transmembrane domain 597 619 N/A INTRINSIC
transmembrane domain 678 700 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
transmembrane domain 819 838 N/A INTRINSIC
low complexity region 854 866 N/A INTRINSIC
low complexity region 871 884 N/A INTRINSIC
transmembrane domain 902 921 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185817
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions early in the glycosylphosphatidylinositol (GPI) biosynthetic pathway, catalyzing the inositol deacylation of GPI. The encoded protein is required for the production of GPI that can attach to proteins, and this may be an important factor in the transport of GPI-anchored proteins from the endoplasmic reticulum to the Golgi. Defects in this gene are a cause of mental retardation, autosomal recessive 42. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mutations in this gene result in a variety of forebrain, eye, jaw, craniofacial, ear, and vertebra defects that are background sensitive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,964,051 I609N unknown Het
Ano10 A T 9: 122,261,242 I277N probably damaging Het
Ap2b1 A G 11: 83,346,673 D483G probably damaging Het
As3mt T A 19: 46,719,952 F226Y probably damaging Het
Atp10a G A 7: 58,803,739 R855H possibly damaging Het
Bin3 T A 14: 70,137,162 H213Q probably benign Het
Bora T C 14: 99,073,667 C512R probably damaging Het
Camk2b T A 11: 5,978,497 D414V probably damaging Het
Ccdc27 A T 4: 154,037,722 L233Q unknown Het
Ccdc73 T C 2: 104,907,633 S25P probably damaging Het
Cenpf G A 1: 189,659,920 H572Y probably benign Het
Chil4 A G 3: 106,204,171 V209A probably damaging Het
Clstn1 T C 4: 149,644,067 V650A probably benign Het
Cox6a2 T A 7: 128,206,265 S11C probably benign Het
Csf1 T C 3: 107,749,001 E238G probably benign Het
Cyp2c23 T A 19: 44,029,187 M1L unknown Het
Cyp4a10 T A 4: 115,524,312 M191K probably damaging Het
Cyp4a14 A G 4: 115,491,131 V383A possibly damaging Het
D130052B06Rik T G 11: 33,623,916 V171G possibly damaging Het
Dlgap2 A G 8: 14,822,369 T617A probably benign Het
Dyrk4 T A 6: 126,886,727 I351F probably damaging Het
Epg5 T C 18: 77,948,370 V94A probably benign Het
Fam111a A G 19: 12,588,443 T519A probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Gdpd4 A G 7: 97,974,462 S314G probably damaging Het
Gm9758 T A 5: 14,912,260 K111N possibly damaging Het
Gpr137b A T 13: 13,363,511 V285E probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Itgal T A 7: 127,330,217 L1102Q probably null Het
Kctd19 T A 8: 105,395,360 Y185F possibly damaging Het
Kif5b A G 18: 6,223,558 L317P possibly damaging Het
Klhl42 C A 6: 147,092,307 A259E probably damaging Het
Lrrc2 A G 9: 110,980,949 D351G probably damaging Het
Med12l A G 3: 59,227,822 E797G probably damaging Het
Mink1 A G 11: 70,598,987 E63G probably damaging Het
Nek9 T C 12: 85,332,329 probably null Het
Olfr1120 A T 2: 87,846,874 H201L possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp6 G A 9: 59,650,012 V627I probably benign Het
Pclo C T 5: 14,522,094 Q498* probably null Het
Pdlim5 T C 3: 142,312,325 T170A possibly damaging Het
Pgghg T A 7: 140,946,184 N563K probably damaging Het
Plxnb2 A G 15: 89,160,713 M1143T probably benign Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Prc1 G A 7: 80,309,427 R381Q probably damaging Het
Psph A T 5: 129,766,465 I175N probably damaging Het
Rbbp8nl T A 2: 180,281,512 K131* probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Sde2 G A 1: 180,855,806 V42I probably benign Het
Slc25a3 G A 10: 91,117,101 R314* probably null Het
Spag9 A G 11: 94,044,507 N48S probably benign Het
Srp54b T C 12: 55,255,972 M351T possibly damaging Het
Tcaf2 A G 6: 42,627,408 L679P probably damaging Het
Tnrc6b T A 15: 80,880,743 N815K probably benign Het
Usp17la A T 7: 104,860,350 Q54L possibly damaging Het
Vmn2r92 T A 17: 18,166,774 I125K probably benign Het
Xrra1 T C 7: 99,917,472 Y732H probably damaging Het
Zfp131 A G 13: 119,766,405 S603P possibly damaging Het
Zfp28 G T 7: 6,393,613 S349I probably benign Het
Other mutations in Pgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Pgap1 APN 1 54492021 splice site probably benign
IGL01111:Pgap1 APN 1 54530943 missense probably benign 0.17
IGL01406:Pgap1 APN 1 54533414 splice site probably null
IGL01592:Pgap1 APN 1 54521311 missense probably damaging 1.00
IGL02005:Pgap1 APN 1 54551055 missense probably damaging 0.99
IGL02026:Pgap1 APN 1 54494819 missense probably benign 0.05
IGL02086:Pgap1 APN 1 54547988 missense probably damaging 1.00
IGL02354:Pgap1 APN 1 54512816 missense probably benign 0.02
IGL02361:Pgap1 APN 1 54512816 missense probably benign 0.02
IGL02995:Pgap1 APN 1 54493350 missense probably benign 0.19
IGL03012:Pgap1 APN 1 54533413 splice site probably benign
R0044:Pgap1 UTSW 1 54493368 missense probably damaging 1.00
R0109:Pgap1 UTSW 1 54494825 missense probably damaging 1.00
R0109:Pgap1 UTSW 1 54494825 missense probably damaging 1.00
R0241:Pgap1 UTSW 1 54535951 splice site probably null
R0241:Pgap1 UTSW 1 54535951 splice site probably null
R0352:Pgap1 UTSW 1 54486458 splice site probably benign
R1297:Pgap1 UTSW 1 54528523 missense possibly damaging 0.94
R1429:Pgap1 UTSW 1 54494861 missense probably benign 0.01
R1465:Pgap1 UTSW 1 54528555 missense probably benign 0.11
R1465:Pgap1 UTSW 1 54528555 missense probably benign 0.11
R1542:Pgap1 UTSW 1 54492090 missense probably benign 0.16
R1816:Pgap1 UTSW 1 54492057 missense probably damaging 0.99
R1817:Pgap1 UTSW 1 54535969 missense probably benign 0.15
R1905:Pgap1 UTSW 1 54511961 missense probably benign 0.26
R2006:Pgap1 UTSW 1 54551061 missense possibly damaging 0.76
R3551:Pgap1 UTSW 1 54530143 missense possibly damaging 0.89
R3833:Pgap1 UTSW 1 54557465 missense probably damaging 0.99
R3901:Pgap1 UTSW 1 54493348 missense probably benign
R4487:Pgap1 UTSW 1 54528592 missense probably benign 0.26
R4874:Pgap1 UTSW 1 54530137 missense probably damaging 0.96
R5184:Pgap1 UTSW 1 54481856 missense probably damaging 1.00
R6181:Pgap1 UTSW 1 54512777 missense probably benign 0.05
R6212:Pgap1 UTSW 1 54514893 missense probably damaging 0.99
R6525:Pgap1 UTSW 1 54481889 missense probably benign 0.00
R6944:Pgap1 UTSW 1 54530161 missense probably damaging 1.00
R7214:Pgap1 UTSW 1 54543061 missense possibly damaging 0.47
R7256:Pgap1 UTSW 1 54493207 critical splice donor site probably null
R7290:Pgap1 UTSW 1 54548066 missense possibly damaging 0.45
R7356:Pgap1 UTSW 1 54530134 missense probably benign 0.10
R7525:Pgap1 UTSW 1 54530922 missense probably benign 0.26
R7602:Pgap1 UTSW 1 54543186 missense probably damaging 1.00
R7897:Pgap1 UTSW 1 54551008 missense probably damaging 1.00
R7980:Pgap1 UTSW 1 54551008 missense probably damaging 1.00
X0025:Pgap1 UTSW 1 54481870 missense probably benign 0.26
X0060:Pgap1 UTSW 1 54536034 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGATAAGGCTAACTCCTTTTC -3'
(R):5'- ATGAAGTCAGATGCTTTCCCAG -3'

Sequencing Primer
(F):5'- ATAAGGCTAACTCCTTTTCTTGGTTC -3'
(R):5'- CAGATGCTTTCCCAGGATGTTG -3'
Posted On2018-03-15