Mutagenetix > Incidental Mutations

Incidental Mutation 'R6269:Pgap1'

507197

Institutional Source

Beutler Lab

Gene Symbol

Pgap1

Ensembl Gene

ENSMUSG00000073678

Gene Name

post-GPI attachment to proteins 1

Synonyms

PGAP1, D230012E17Rik, oto, 5033403E17Rik, 9030223K07Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.788) question?

Stock #

R6269 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

54472994-54557684 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 54548008 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 136 (Y136*)

Ref Sequence

ENSEMBL: ENSMUSP00000095346 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097739]

Predicted Effect

probably null
Transcript: ENSMUST00000097739
AA Change: Y136*

SMART Domains

Protein: ENSMUSP00000095346
Gene: ENSMUSG00000073678
AA Change: Y136*

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:PGAP1	82	302	7.2e-83	PFAM
transmembrane domain	597	619	N/A	INTRINSIC
transmembrane domain	678	700	N/A	INTRINSIC
transmembrane domain	737	759	N/A	INTRINSIC
transmembrane domain	819	838	N/A	INTRINSIC
low complexity region	854	866	N/A	INTRINSIC
low complexity region	871	884	N/A	INTRINSIC
transmembrane domain	902	921	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185817

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions early in the glycosylphosphatidylinositol (GPI) biosynthetic pathway, catalyzing the inositol deacylation of GPI. The encoded protein is required for the production of GPI that can attach to proteins, and this may be an important factor in the transport of GPI-anchored proteins from the endoplasmic reticulum to the Golgi. Defects in this gene are a cause of mental retardation, autosomal recessive 42. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mutations in this gene result in a variety of forebrain, eye, jaw, craniofacial, ear, and vertebra defects that are background sensitive. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	T	A	6: 86,964,051	I609N	unknown	Het
Ano10	A	T	9: 122,261,242	I277N	probably damaging	Het
Ap2b1	A	G	11: 83,346,673	D483G	probably damaging	Het
As3mt	T	A	19: 46,719,952	F226Y	probably damaging	Het
Atp10a	G	A	7: 58,803,739	R855H	possibly damaging	Het
Bin3	T	A	14: 70,137,162	H213Q	probably benign	Het
Bora	T	C	14: 99,073,667	C512R	probably damaging	Het
Camk2b	T	A	11: 5,978,497	D414V	probably damaging	Het
Ccdc27	A	T	4: 154,037,722	L233Q	unknown	Het
Ccdc73	T	C	2: 104,907,633	S25P	probably damaging	Het
Cenpf	G	A	1: 189,659,920	H572Y	probably benign	Het
Chil4	A	G	3: 106,204,171	V209A	probably damaging	Het
Clstn1	T	C	4: 149,644,067	V650A	probably benign	Het
Cox6a2	T	A	7: 128,206,265	S11C	probably benign	Het
Csf1	T	C	3: 107,749,001	E238G	probably benign	Het
Cyp2c23	T	A	19: 44,029,187	M1L	unknown	Het
Cyp4a10	T	A	4: 115,524,312	M191K	probably damaging	Het
Cyp4a14	A	G	4: 115,491,131	V383A	possibly damaging	Het
D130052B06Rik	T	G	11: 33,623,916	V171G	possibly damaging	Het
Dlgap2	A	G	8: 14,822,369	T617A	probably benign	Het
Dyrk4	T	A	6: 126,886,727	I351F	probably damaging	Het
Epg5	T	C	18: 77,948,370	V94A	probably benign	Het
Fam111a	A	G	19: 12,588,443	T519A	probably benign	Het
Fam208b	C	T	13: 3,581,891	R870H	possibly damaging	Het
Gdpd4	A	G	7: 97,974,462	S314G	probably damaging	Het
Gm9758	T	A	5: 14,912,260	K111N	possibly damaging	Het
Gpr137b	A	T	13: 13,363,511	V285E	probably damaging	Het
Hyls1	G	A	9: 35,561,184	S312F	probably benign	Het
Itgal	T	A	7: 127,330,217	L1102Q	probably null	Het
Kctd19	T	A	8: 105,395,360	Y185F	possibly damaging	Het
Kif5b	A	G	18: 6,223,558	L317P	possibly damaging	Het
Klhl42	C	A	6: 147,092,307	A259E	probably damaging	Het
Lrrc2	A	G	9: 110,980,949	D351G	probably damaging	Het
Med12l	A	G	3: 59,227,822	E797G	probably damaging	Het
Mink1	A	G	11: 70,598,987	E63G	probably damaging	Het
Nek9	T	C	12: 85,332,329		probably null	Het
Olfr1120	A	T	2: 87,846,874	H201L	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Parp6	G	A	9: 59,650,012	V627I	probably benign	Het
Pclo	C	T	5: 14,522,094	Q498*	probably null	Het
Pdlim5	T	C	3: 142,312,325	T170A	possibly damaging	Het
Pgghg	T	A	7: 140,946,184	N563K	probably damaging	Het
Plxnb2	A	G	15: 89,160,713	M1143T	probably benign	Het
Pnpla1	G	A	17: 28,881,368	G403E	probably benign	Het
Prc1	G	A	7: 80,309,427	R381Q	probably damaging	Het
Psph	A	T	5: 129,766,465	I175N	probably damaging	Het
Rbbp8nl	T	A	2: 180,281,512	K131*	probably null	Het
Rsf1	GGCG	GGCGACGGCCGCG	7: 97,579,906		probably benign	Homo
Sde2	G	A	1: 180,855,806	V42I	probably benign	Het
Slc25a3	G	A	10: 91,117,101	R314*	probably null	Het
Spag9	A	G	11: 94,044,507	N48S	probably benign	Het
Srp54b	T	C	12: 55,255,972	M351T	possibly damaging	Het
Tcaf2	A	G	6: 42,627,408	L679P	probably damaging	Het
Tnrc6b	T	A	15: 80,880,743	N815K	probably benign	Het
Usp17la	A	T	7: 104,860,350	Q54L	possibly damaging	Het
Vmn2r92	T	A	17: 18,166,774	I125K	probably benign	Het
Xrra1	T	C	7: 99,917,472	Y732H	probably damaging	Het
Zfp131	A	G	13: 119,766,405	S603P	possibly damaging	Het
Zfp28	G	T	7: 6,393,613	S349I	probably benign	Het

Other mutations in Pgap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00846:Pgap1	APN	1	54492021	splice site	probably benign
IGL01111:Pgap1	APN	1	54530943	missense	probably benign	0.17
IGL01406:Pgap1	APN	1	54533414	splice site	probably null
IGL01592:Pgap1	APN	1	54521311	missense	probably damaging	1.00
IGL02005:Pgap1	APN	1	54551055	missense	probably damaging	0.99
IGL02026:Pgap1	APN	1	54494819	missense	probably benign	0.05
IGL02086:Pgap1	APN	1	54547988	missense	probably damaging	1.00
IGL02354:Pgap1	APN	1	54512816	missense	probably benign	0.02
IGL02361:Pgap1	APN	1	54512816	missense	probably benign	0.02
IGL02995:Pgap1	APN	1	54493350	missense	probably benign	0.19
IGL03012:Pgap1	APN	1	54533413	splice site	probably benign
R0044:Pgap1	UTSW	1	54493368	missense	probably damaging	1.00
R0109:Pgap1	UTSW	1	54494825	missense	probably damaging	1.00
R0109:Pgap1	UTSW	1	54494825	missense	probably damaging	1.00
R0241:Pgap1	UTSW	1	54535951	splice site	probably null
R0241:Pgap1	UTSW	1	54535951	splice site	probably null
R0352:Pgap1	UTSW	1	54486458	splice site	probably benign
R1297:Pgap1	UTSW	1	54528523	missense	possibly damaging	0.94
R1429:Pgap1	UTSW	1	54494861	missense	probably benign	0.01
R1465:Pgap1	UTSW	1	54528555	missense	probably benign	0.11
R1465:Pgap1	UTSW	1	54528555	missense	probably benign	0.11
R1542:Pgap1	UTSW	1	54492090	missense	probably benign	0.16
R1816:Pgap1	UTSW	1	54492057	missense	probably damaging	0.99
R1817:Pgap1	UTSW	1	54535969	missense	probably benign	0.15
R1905:Pgap1	UTSW	1	54511961	missense	probably benign	0.26
R2006:Pgap1	UTSW	1	54551061	missense	possibly damaging	0.76
R3551:Pgap1	UTSW	1	54530143	missense	possibly damaging	0.89
R3833:Pgap1	UTSW	1	54557465	missense	probably damaging	0.99
R3901:Pgap1	UTSW	1	54493348	missense	probably benign
R4487:Pgap1	UTSW	1	54528592	missense	probably benign	0.26
R4874:Pgap1	UTSW	1	54530137	missense	probably damaging	0.96
R5184:Pgap1	UTSW	1	54481856	missense	probably damaging	1.00
R6181:Pgap1	UTSW	1	54512777	missense	probably benign	0.05
R6212:Pgap1	UTSW	1	54514893	missense	probably damaging	0.99
R6525:Pgap1	UTSW	1	54481889	missense	probably benign	0.00
R6944:Pgap1	UTSW	1	54530161	missense	probably damaging	1.00
R7214:Pgap1	UTSW	1	54543061	missense	possibly damaging	0.47
R7256:Pgap1	UTSW	1	54493207	critical splice donor site	probably null
R7290:Pgap1	UTSW	1	54548066	missense	possibly damaging	0.45
R7356:Pgap1	UTSW	1	54530134	missense	probably benign	0.10
R7525:Pgap1	UTSW	1	54530922	missense	probably benign	0.26
R7602:Pgap1	UTSW	1	54543186	missense	probably damaging	1.00
R7897:Pgap1	UTSW	1	54551008	missense	probably damaging	1.00
R8278:Pgap1	UTSW	1	54490271	missense	probably benign
X0025:Pgap1	UTSW	1	54481870	missense	probably benign	0.26
X0060:Pgap1	UTSW	1	54536034	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTGATAAGGCTAACTCCTTTTC -3'
(R):5'- ATGAAGTCAGATGCTTTCCCAG -3'

Sequencing Primer
(F):5'- ATAAGGCTAACTCCTTTTCTTGGTTC -3'
(R):5'- CAGATGCTTTCCCAGGATGTTG -3'

Posted On

2018-03-15