Incidental Mutation 'R6269:Olfr1120'
ID507200
Institutional Source Beutler Lab
Gene Symbol Olfr1120
Ensembl Gene ENSMUSG00000081234
Gene Nameolfactory receptor 1120
SynonymsMOR264-2, GA_x6K02T2Q125-48849180-48850100
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R6269 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location87354815-87361786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87846874 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 201 (H201L)
Ref Sequence ENSEMBL: ENSMUSP00000150363 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000121186
AA Change: H201L

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,964,051 I609N unknown Het
Ano10 A T 9: 122,261,242 I277N probably damaging Het
Ap2b1 A G 11: 83,346,673 D483G probably damaging Het
As3mt T A 19: 46,719,952 F226Y probably damaging Het
Atp10a G A 7: 58,803,739 R855H possibly damaging Het
Bin3 T A 14: 70,137,162 H213Q probably benign Het
Bora T C 14: 99,073,667 C512R probably damaging Het
Camk2b T A 11: 5,978,497 D414V probably damaging Het
Ccdc27 A T 4: 154,037,722 L233Q unknown Het
Ccdc73 T C 2: 104,907,633 S25P probably damaging Het
Cenpf G A 1: 189,659,920 H572Y probably benign Het
Chil4 A G 3: 106,204,171 V209A probably damaging Het
Clstn1 T C 4: 149,644,067 V650A probably benign Het
Cox6a2 T A 7: 128,206,265 S11C probably benign Het
Csf1 T C 3: 107,749,001 E238G probably benign Het
Cyp2c23 T A 19: 44,029,187 M1L unknown Het
Cyp4a10 T A 4: 115,524,312 M191K probably damaging Het
Cyp4a14 A G 4: 115,491,131 V383A possibly damaging Het
D130052B06Rik T G 11: 33,623,916 V171G possibly damaging Het
Dlgap2 A G 8: 14,822,369 T617A probably benign Het
Dyrk4 T A 6: 126,886,727 I351F probably damaging Het
Epg5 T C 18: 77,948,370 V94A probably benign Het
Fam111a A G 19: 12,588,443 T519A probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Gdpd4 A G 7: 97,974,462 S314G probably damaging Het
Gm9758 T A 5: 14,912,260 K111N possibly damaging Het
Gpr137b A T 13: 13,363,511 V285E probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Itgal T A 7: 127,330,217 L1102Q probably null Het
Kctd19 T A 8: 105,395,360 Y185F possibly damaging Het
Kif5b A G 18: 6,223,558 L317P possibly damaging Het
Klhl42 C A 6: 147,092,307 A259E probably damaging Het
Lrrc2 A G 9: 110,980,949 D351G probably damaging Het
Med12l A G 3: 59,227,822 E797G probably damaging Het
Mink1 A G 11: 70,598,987 E63G probably damaging Het
Nek9 T C 12: 85,332,329 probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp6 G A 9: 59,650,012 V627I probably benign Het
Pclo C T 5: 14,522,094 Q498* probably null Het
Pdlim5 T C 3: 142,312,325 T170A possibly damaging Het
Pgap1 A T 1: 54,548,008 Y136* probably null Het
Pgghg T A 7: 140,946,184 N563K probably damaging Het
Plxnb2 A G 15: 89,160,713 M1143T probably benign Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Prc1 G A 7: 80,309,427 R381Q probably damaging Het
Psph A T 5: 129,766,465 I175N probably damaging Het
Rbbp8nl T A 2: 180,281,512 K131* probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Sde2 G A 1: 180,855,806 V42I probably benign Het
Slc25a3 G A 10: 91,117,101 R314* probably null Het
Spag9 A G 11: 94,044,507 N48S probably benign Het
Srp54b T C 12: 55,255,972 M351T possibly damaging Het
Tcaf2 A G 6: 42,627,408 L679P probably damaging Het
Tnrc6b T A 15: 80,880,743 N815K probably benign Het
Usp17la A T 7: 104,860,350 Q54L possibly damaging Het
Vmn2r92 T A 17: 18,166,774 I125K probably benign Het
Xrra1 T C 7: 99,917,472 Y732H probably damaging Het
Zfp131 A G 13: 119,766,405 S603P possibly damaging Het
Zfp28 G T 7: 6,393,613 S349I probably benign Het
Other mutations in Olfr1120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01142:Olfr1120 APN 2 87357545 missense possibly damaging 0.82
IGL01680:Olfr1120 APN 2 87357905 missense probably damaging 1.00
IGL02210:Olfr1120 APN 2 87358003 missense probably damaging 1.00
R0624:Olfr1120 UTSW 2 87357682 nonsense probably null
R0849:Olfr1120 UTSW 2 87358265 missense probably benign 0.00
R1298:Olfr1120 UTSW 2 87358070 missense probably benign 0.20
R2309:Olfr1120 UTSW 2 87357954 missense probably damaging 1.00
R4237:Olfr1120 UTSW 2 87358253 missense probably damaging 1.00
R4291:Olfr1120 UTSW 2 87358075 missense probably benign 0.00
R5679:Olfr1120 UTSW 2 87357545 missense possibly damaging 0.82
R5939:Olfr1120 UTSW 2 87357704 missense possibly damaging 0.55
R6551:Olfr1120 UTSW 2 87846661 missense possibly damaging 0.89
R7024:Olfr1120 UTSW 2 87357722 missense probably benign 0.06
R7242:Olfr1120 UTSW 2 87358082 missense probably benign 0.13
R7359:Olfr1120 UTSW 2 87358211 missense possibly damaging 0.77
R7444:Olfr1120 UTSW 2 87358100 missense possibly damaging 0.94
R7488:Olfr1120 UTSW 2 87358253 missense probably damaging 1.00
R7646:Olfr1120 UTSW 2 87357758 missense probably benign 0.00
R7711:Olfr1120 UTSW 2 87357527 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AATGCAAACAGCTGGCAGC -3'
(R):5'- AGTTTGTCAGTACCAGGGGAATG -3'

Sequencing Primer
(F):5'- AGCAGTCTCCTGGCTTGG -3'
(R):5'- GCATGGACTTTGGTCTCAAATAG -3'
Posted On2018-03-15