Incidental Mutation 'R6269:Cyp4a14'
ID 507207
Institutional Source Beutler Lab
Gene Symbol Cyp4a14
Ensembl Gene ENSMUSG00000028715
Gene Name cytochrome P450, family 4, subfamily a, polypeptide 14
Synonyms
MMRRC Submission 044440-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R6269 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 115343397-115353339 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 115348328 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 383 (V383A)
Ref Sequence ENSEMBL: ENSMUSP00000030487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030487]
AlphaFold O35728
Predicted Effect possibly damaging
Transcript: ENSMUST00000030487
AA Change: V383A

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715
AA Change: V383A

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 503 5.4e-129 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124412
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,941,033 (GRCm39) I609N unknown Het
Ano10 A T 9: 122,090,308 (GRCm39) I277N probably damaging Het
Ap2b1 A G 11: 83,237,499 (GRCm39) D483G probably damaging Het
As3mt T A 19: 46,708,391 (GRCm39) F226Y probably damaging Het
Atp10a G A 7: 58,453,487 (GRCm39) R855H possibly damaging Het
Bin3 T A 14: 70,374,611 (GRCm39) H213Q probably benign Het
Bora T C 14: 99,311,103 (GRCm39) C512R probably damaging Het
Camk2b T A 11: 5,928,497 (GRCm39) D414V probably damaging Het
Ccdc27 A T 4: 154,122,179 (GRCm39) L233Q unknown Het
Ccdc73 T C 2: 104,737,978 (GRCm39) S25P probably damaging Het
Cenpf G A 1: 189,392,117 (GRCm39) H572Y probably benign Het
Chil4 A G 3: 106,111,487 (GRCm39) V209A probably damaging Het
Clstn1 T C 4: 149,728,524 (GRCm39) V650A probably benign Het
Cox6a2 T A 7: 127,805,437 (GRCm39) S11C probably benign Het
Csf1 T C 3: 107,656,317 (GRCm39) E238G probably benign Het
Cyp2c23 T A 19: 44,017,626 (GRCm39) M1L unknown Het
Cyp4a10 T A 4: 115,381,509 (GRCm39) M191K probably damaging Het
D130052B06Rik T G 11: 33,573,916 (GRCm39) V171G possibly damaging Het
Dlgap2 A G 8: 14,872,369 (GRCm39) T617A probably benign Het
Dyrk4 T A 6: 126,863,690 (GRCm39) I351F probably damaging Het
Epg5 T C 18: 77,991,585 (GRCm39) V94A probably benign Het
Fam111a A G 19: 12,565,807 (GRCm39) T519A probably benign Het
Gdpd4 A G 7: 97,623,669 (GRCm39) S314G probably damaging Het
Gm9758 T A 5: 14,962,274 (GRCm39) K111N possibly damaging Het
Gpr137b A T 13: 13,538,096 (GRCm39) V285E probably damaging Het
Hyls1 G A 9: 35,472,480 (GRCm39) S312F probably benign Het
Itgal T A 7: 126,929,389 (GRCm39) L1102Q probably null Het
Kctd19 T A 8: 106,121,992 (GRCm39) Y185F possibly damaging Het
Kif5b A G 18: 6,223,558 (GRCm39) L317P possibly damaging Het
Klhl42 C A 6: 146,993,805 (GRCm39) A259E probably damaging Het
Lrrc2 A G 9: 110,810,017 (GRCm39) D351G probably damaging Het
Med12l A G 3: 59,135,243 (GRCm39) E797G probably damaging Het
Mink1 A G 11: 70,489,813 (GRCm39) E63G probably damaging Het
Nek9 T C 12: 85,379,103 (GRCm39) probably null Het
Or12e8 A T 2: 87,677,218 (GRCm39) H201L possibly damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Parp6 G A 9: 59,557,295 (GRCm39) V627I probably benign Het
Pclo C T 5: 14,572,108 (GRCm39) Q498* probably null Het
Pdlim5 T C 3: 142,018,086 (GRCm39) T170A possibly damaging Het
Pgap1 A T 1: 54,587,167 (GRCm39) Y136* probably null Het
Pgghg T A 7: 140,526,097 (GRCm39) N563K probably damaging Het
Plxnb2 A G 15: 89,044,916 (GRCm39) M1143T probably benign Het
Pnpla1 G A 17: 29,100,342 (GRCm39) G403E probably benign Het
Prc1 G A 7: 79,959,175 (GRCm39) R381Q probably damaging Het
Psph A T 5: 129,843,529 (GRCm39) I175N probably damaging Het
Rbbp8nl T A 2: 179,923,305 (GRCm39) K131* probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,229,113 (GRCm39) probably benign Homo
Sde2 G A 1: 180,683,371 (GRCm39) V42I probably benign Het
Slc25a3 G A 10: 90,952,963 (GRCm39) R314* probably null Het
Spag9 A G 11: 93,935,333 (GRCm39) N48S probably benign Het
Srp54b T C 12: 55,302,757 (GRCm39) M351T possibly damaging Het
Tasor2 C T 13: 3,631,891 (GRCm39) R870H possibly damaging Het
Tcaf2 A G 6: 42,604,342 (GRCm39) L679P probably damaging Het
Tnrc6b T A 15: 80,764,944 (GRCm39) N815K probably benign Het
Usp17la A T 7: 104,509,557 (GRCm39) Q54L possibly damaging Het
Vmn2r92 T A 17: 18,387,036 (GRCm39) I125K probably benign Het
Xrra1 T C 7: 99,566,679 (GRCm39) Y732H probably damaging Het
Zfp131 A G 13: 120,227,941 (GRCm39) S603P possibly damaging Het
Zfp28 G T 7: 6,396,612 (GRCm39) S349I probably benign Het
Other mutations in Cyp4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cyp4a14 APN 4 115,347,149 (GRCm39) splice site probably benign
IGL01539:Cyp4a14 APN 4 115,344,374 (GRCm39) missense possibly damaging 0.71
IGL01802:Cyp4a14 APN 4 115,352,134 (GRCm39) nonsense probably null
IGL02309:Cyp4a14 APN 4 115,348,829 (GRCm39) missense probably damaging 0.99
IGL02330:Cyp4a14 APN 4 115,352,224 (GRCm39) splice site probably benign
IGL03302:Cyp4a14 APN 4 115,348,575 (GRCm39) missense probably benign 0.00
R1037:Cyp4a14 UTSW 4 115,347,193 (GRCm39) missense probably damaging 1.00
R1236:Cyp4a14 UTSW 4 115,349,367 (GRCm39) missense probably benign 0.01
R2132:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2133:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2873:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R4015:Cyp4a14 UTSW 4 115,348,331 (GRCm39) missense probably damaging 1.00
R4925:Cyp4a14 UTSW 4 115,353,133 (GRCm39) missense possibly damaging 0.68
R5104:Cyp4a14 UTSW 4 115,353,126 (GRCm39) missense probably damaging 1.00
R5135:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R5150:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R5930:Cyp4a14 UTSW 4 115,348,607 (GRCm39) missense probably damaging 1.00
R5997:Cyp4a14 UTSW 4 115,353,297 (GRCm39) nonsense probably null
R6354:Cyp4a14 UTSW 4 115,344,441 (GRCm39) missense probably damaging 1.00
R6377:Cyp4a14 UTSW 4 115,353,280 (GRCm39) missense probably benign 0.01
R6534:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R6563:Cyp4a14 UTSW 4 115,349,283 (GRCm39) missense probably benign 0.23
R6751:Cyp4a14 UTSW 4 115,348,391 (GRCm39) missense probably damaging 0.99
R7039:Cyp4a14 UTSW 4 115,348,278 (GRCm39) missense probably benign 0.23
R7125:Cyp4a14 UTSW 4 115,348,358 (GRCm39) missense probably damaging 1.00
R7379:Cyp4a14 UTSW 4 115,350,907 (GRCm39) splice site probably null
R7544:Cyp4a14 UTSW 4 115,348,283 (GRCm39) missense probably damaging 0.98
R7591:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R7740:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R7741:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R7753:Cyp4a14 UTSW 4 115,350,861 (GRCm39) missense probably damaging 1.00
R7789:Cyp4a14 UTSW 4 115,352,107 (GRCm39) missense probably benign 0.00
R8064:Cyp4a14 UTSW 4 115,352,155 (GRCm39) missense probably benign
R8311:Cyp4a14 UTSW 4 115,348,275 (GRCm39) missense probably damaging 1.00
R8458:Cyp4a14 UTSW 4 115,353,129 (GRCm39) missense probably damaging 1.00
R8868:Cyp4a14 UTSW 4 115,348,553 (GRCm39) missense probably damaging 1.00
R9039:Cyp4a14 UTSW 4 115,344,461 (GRCm39) missense probably damaging 0.97
R9632:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
R9710:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
Z1176:Cyp4a14 UTSW 4 115,347,214 (GRCm39) missense probably benign 0.01
Z1177:Cyp4a14 UTSW 4 115,348,650 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ACGTGACTGCAATTTCAAGTC -3'
(R):5'- CCTCTGTCACATGGTAAGAACC -3'

Sequencing Primer
(F):5'- AGCTGAAGCCATGTGTACTC -3'
(R):5'- ACCACTCACTTGTCTTTTTATAGGAG -3'
Posted On 2018-03-15