Incidental Mutation 'R6269:Cyp4a10'
ID507208
Institutional Source Beutler Lab
Gene Symbol Cyp4a10
Ensembl Gene ENSMUSG00000066072
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 10
SynonymsRP1, D4Rp1, Cyp4a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6269 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location115518264-115533649 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115524312 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 191 (M191K)
Ref Sequence ENSEMBL: ENSMUSP00000061126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058785] [ENSMUST00000094886]
Predicted Effect probably damaging
Transcript: ENSMUST00000058785
AA Change: M191K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061126
Gene: ENSMUSG00000066072
AA Change: M191K

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 504 2.3e-133 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094886
AA Change: M181K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092486
Gene: ENSMUSG00000066072
AA Change: M181K

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
Pfam:p450 51 494 4.5e-129 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display salt-sensitive hypertension, decrease sodium excretion, and decreased urine output. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,964,051 I609N unknown Het
Ano10 A T 9: 122,261,242 I277N probably damaging Het
Ap2b1 A G 11: 83,346,673 D483G probably damaging Het
As3mt T A 19: 46,719,952 F226Y probably damaging Het
Atp10a G A 7: 58,803,739 R855H possibly damaging Het
Bin3 T A 14: 70,137,162 H213Q probably benign Het
Bora T C 14: 99,073,667 C512R probably damaging Het
Camk2b T A 11: 5,978,497 D414V probably damaging Het
Ccdc27 A T 4: 154,037,722 L233Q unknown Het
Ccdc73 T C 2: 104,907,633 S25P probably damaging Het
Cenpf G A 1: 189,659,920 H572Y probably benign Het
Chil4 A G 3: 106,204,171 V209A probably damaging Het
Clstn1 T C 4: 149,644,067 V650A probably benign Het
Cox6a2 T A 7: 128,206,265 S11C probably benign Het
Csf1 T C 3: 107,749,001 E238G probably benign Het
Cyp2c23 T A 19: 44,029,187 M1L unknown Het
Cyp4a14 A G 4: 115,491,131 V383A possibly damaging Het
D130052B06Rik T G 11: 33,623,916 V171G possibly damaging Het
Dlgap2 A G 8: 14,822,369 T617A probably benign Het
Dyrk4 T A 6: 126,886,727 I351F probably damaging Het
Epg5 T C 18: 77,948,370 V94A probably benign Het
Fam111a A G 19: 12,588,443 T519A probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Gdpd4 A G 7: 97,974,462 S314G probably damaging Het
Gm9758 T A 5: 14,912,260 K111N possibly damaging Het
Gpr137b A T 13: 13,363,511 V285E probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Itgal T A 7: 127,330,217 L1102Q probably null Het
Kctd19 T A 8: 105,395,360 Y185F possibly damaging Het
Kif5b A G 18: 6,223,558 L317P possibly damaging Het
Klhl42 C A 6: 147,092,307 A259E probably damaging Het
Lrrc2 A G 9: 110,980,949 D351G probably damaging Het
Med12l A G 3: 59,227,822 E797G probably damaging Het
Mink1 A G 11: 70,598,987 E63G probably damaging Het
Nek9 T C 12: 85,332,329 probably null Het
Olfr1120 A T 2: 87,846,874 H201L possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp6 G A 9: 59,650,012 V627I probably benign Het
Pclo C T 5: 14,522,094 Q498* probably null Het
Pdlim5 T C 3: 142,312,325 T170A possibly damaging Het
Pgap1 A T 1: 54,548,008 Y136* probably null Het
Pgghg T A 7: 140,946,184 N563K probably damaging Het
Plxnb2 A G 15: 89,160,713 M1143T probably benign Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Prc1 G A 7: 80,309,427 R381Q probably damaging Het
Psph A T 5: 129,766,465 I175N probably damaging Het
Rbbp8nl T A 2: 180,281,512 K131* probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Sde2 G A 1: 180,855,806 V42I probably benign Het
Slc25a3 G A 10: 91,117,101 R314* probably null Het
Spag9 A G 11: 94,044,507 N48S probably benign Het
Srp54b T C 12: 55,255,972 M351T possibly damaging Het
Tcaf2 A G 6: 42,627,408 L679P probably damaging Het
Tnrc6b T A 15: 80,880,743 N815K probably benign Het
Usp17la A T 7: 104,860,350 Q54L possibly damaging Het
Vmn2r92 T A 17: 18,166,774 I125K probably benign Het
Xrra1 T C 7: 99,917,472 Y732H probably damaging Het
Zfp131 A G 13: 119,766,405 S603P possibly damaging Het
Zfp28 G T 7: 6,393,613 S349I probably benign Het
Other mutations in Cyp4a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00774:Cyp4a10 APN 4 115532538 missense probably damaging 1.00
IGL01301:Cyp4a10 APN 4 115518455 missense probably damaging 1.00
IGL02081:Cyp4a10 APN 4 115521172 missense possibly damaging 0.87
IGL02373:Cyp4a10 APN 4 115521077 nonsense probably null
IGL03411:Cyp4a10 APN 4 115525693 splice site probably null
ANU18:Cyp4a10 UTSW 4 115518455 missense probably damaging 1.00
PIT4142001:Cyp4a10 UTSW 4 115524875 missense probably damaging 0.99
PIT4151001:Cyp4a10 UTSW 4 115524875 missense probably damaging 0.99
R0016:Cyp4a10 UTSW 4 115521107 missense probably damaging 1.00
R0368:Cyp4a10 UTSW 4 115525377 nonsense probably null
R1319:Cyp4a10 UTSW 4 115521145 missense probably damaging 0.98
R1440:Cyp4a10 UTSW 4 115529449 missense probably damaging 1.00
R1531:Cyp4a10 UTSW 4 115518435 nonsense probably null
R2008:Cyp4a10 UTSW 4 115525392 missense probably damaging 0.98
R2064:Cyp4a10 UTSW 4 115524720 splice site probably benign
R2083:Cyp4a10 UTSW 4 115525308 missense possibly damaging 0.86
R2961:Cyp4a10 UTSW 4 115520270 missense probably benign 0.02
R3028:Cyp4a10 UTSW 4 115518431 missense possibly damaging 0.64
R3839:Cyp4a10 UTSW 4 115525347 missense possibly damaging 0.85
R3930:Cyp4a10 UTSW 4 115524783 missense probably benign 0.00
R4062:Cyp4a10 UTSW 4 115519701 missense probably benign 0.06
R4097:Cyp4a10 UTSW 4 115529283 missense probably damaging 0.99
R4298:Cyp4a10 UTSW 4 115532692 missense probably damaging 1.00
R4482:Cyp4a10 UTSW 4 115532598 missense probably damaging 1.00
R4592:Cyp4a10 UTSW 4 115529493 missense probably damaging 0.99
R4715:Cyp4a10 UTSW 4 115525338 missense probably benign 0.44
R4826:Cyp4a10 UTSW 4 115518344 missense probably benign 0.00
R4834:Cyp4a10 UTSW 4 115525808 missense probably damaging 1.00
R4922:Cyp4a10 UTSW 4 115521094 missense probably benign 0.01
R5202:Cyp4a10 UTSW 4 115532615 missense probably damaging 1.00
R5502:Cyp4a10 UTSW 4 115525505 missense probably benign 0.21
R6349:Cyp4a10 UTSW 4 115525358 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCGTTGCTTATCAGATAAGAC -3'
(R):5'- CAGAGGCTGGGGTAATACTCTC -3'

Sequencing Primer
(F):5'- GTGAAACTTGCTTCCTTTCTTATGAG -3'
(R):5'- CTATTGGGTATTCTAGATGTCCCAC -3'
Posted On2018-03-15