Mutagenetix > Incidental Mutation

Incidental Mutation 'R6269:Ap2b1'

507239

Institutional Source

Beutler Lab

Gene Symbol

Ap2b1

Ensembl Gene

ENSMUSG00000035152

Gene Name

adaptor-related protein complex 2, beta 1 subunit

Synonyms

1300012O03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6269 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

83299024-83405035 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 83346673 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 483 (D483G)

Ref Sequence

ENSEMBL: ENSMUSP00000135445 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523]

AlphaFold

Q9DBG3

Predicted Effect

probably damaging
Transcript: ENSMUST00000018875
AA Change: D521G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: D521G

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	2.6e-173	PFAM
Pfam:HEAT_2	88	157	3.7e-8	PFAM
Pfam:Cnd1	99	268	2.1e-40	PFAM
Pfam:HEAT_2	124	219	1.4e-9	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	950	9.93e-56	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000065692
AA Change: D521G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: D521G

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4.2e-173	PFAM
Pfam:HEAT_2	88	157	2.7e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
Alpha_adaptinC2	707	817	2.94e-18	SMART
B2-adapt-app_C	826	936	9.93e-56	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132178

Predicted Effect

probably damaging
Transcript: ENSMUST00000176430
AA Change: D521G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: D521G

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4e-173	PFAM
Pfam:HEAT_2	88	157	2.8e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	936	7.22e-35	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000176523
AA Change: D483G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152
AA Change: D483G

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	95	1.1e-26	PFAM
Pfam:Cnd1	69	230	1.5e-26	PFAM
Pfam:HEAT_2	85	182	5.1e-9	PFAM
Pfam:Adaptin_N	90	496	4e-125	PFAM
low complexity region	587	605	N/A	INTRINSIC
low complexity region	616	637	N/A	INTRINSIC
Alpha_adaptinC2	683	793	2.94e-18	SMART
B2-adapt-app_C	802	912	9.93e-56	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	T	A	6: 86,964,051	I609N	unknown	Het
Ano10	A	T	9: 122,261,242	I277N	probably damaging	Het
As3mt	T	A	19: 46,719,952	F226Y	probably damaging	Het
Atp10a	G	A	7: 58,803,739	R855H	possibly damaging	Het
Bin3	T	A	14: 70,137,162	H213Q	probably benign	Het
Bora	T	C	14: 99,073,667	C512R	probably damaging	Het
Camk2b	T	A	11: 5,978,497	D414V	probably damaging	Het
Ccdc27	A	T	4: 154,037,722	L233Q	unknown	Het
Ccdc73	T	C	2: 104,907,633	S25P	probably damaging	Het
Cenpf	G	A	1: 189,659,920	H572Y	probably benign	Het
Chil4	A	G	3: 106,204,171	V209A	probably damaging	Het
Clstn1	T	C	4: 149,644,067	V650A	probably benign	Het
Cox6a2	T	A	7: 128,206,265	S11C	probably benign	Het
Csf1	T	C	3: 107,749,001	E238G	probably benign	Het
Cyp2c23	T	A	19: 44,029,187	M1L	unknown	Het
Cyp4a10	T	A	4: 115,524,312	M191K	probably damaging	Het
Cyp4a14	A	G	4: 115,491,131	V383A	possibly damaging	Het
D130052B06Rik	T	G	11: 33,623,916	V171G	possibly damaging	Het
Dlgap2	A	G	8: 14,822,369	T617A	probably benign	Het
Dyrk4	T	A	6: 126,886,727	I351F	probably damaging	Het
Epg5	T	C	18: 77,948,370	V94A	probably benign	Het
Fam111a	A	G	19: 12,588,443	T519A	probably benign	Het
Fam208b	C	T	13: 3,581,891	R870H	possibly damaging	Het
Gdpd4	A	G	7: 97,974,462	S314G	probably damaging	Het
Gm9758	T	A	5: 14,912,260	K111N	possibly damaging	Het
Gpr137b	A	T	13: 13,363,511	V285E	probably damaging	Het
Hyls1	G	A	9: 35,561,184	S312F	probably benign	Het
Itgal	T	A	7: 127,330,217	L1102Q	probably null	Het
Kctd19	T	A	8: 105,395,360	Y185F	possibly damaging	Het
Kif5b	A	G	18: 6,223,558	L317P	possibly damaging	Het
Klhl42	C	A	6: 147,092,307	A259E	probably damaging	Het
Lrrc2	A	G	9: 110,980,949	D351G	probably damaging	Het
Med12l	A	G	3: 59,227,822	E797G	probably damaging	Het
Mink1	A	G	11: 70,598,987	E63G	probably damaging	Het
Nek9	T	C	12: 85,332,329		probably null	Het
Olfr1120	A	T	2: 87,846,874	H201L	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Parp6	G	A	9: 59,650,012	V627I	probably benign	Het
Pclo	C	T	5: 14,522,094	Q498*	probably null	Het
Pdlim5	T	C	3: 142,312,325	T170A	possibly damaging	Het
Pgap1	A	T	1: 54,548,008	Y136*	probably null	Het
Pgghg	T	A	7: 140,946,184	N563K	probably damaging	Het
Plxnb2	A	G	15: 89,160,713	M1143T	probably benign	Het
Pnpla1	G	A	17: 28,881,368	G403E	probably benign	Het
Prc1	G	A	7: 80,309,427	R381Q	probably damaging	Het
Psph	A	T	5: 129,766,465	I175N	probably damaging	Het
Rbbp8nl	T	A	2: 180,281,512	K131*	probably null	Het
Rsf1	GGCG	GGCGACGGCCGCG	7: 97,579,906		probably benign	Homo
Sde2	G	A	1: 180,855,806	V42I	probably benign	Het
Slc25a3	G	A	10: 91,117,101	R314*	probably null	Het
Spag9	A	G	11: 94,044,507	N48S	probably benign	Het
Srp54b	T	C	12: 55,255,972	M351T	possibly damaging	Het
Tcaf2	A	G	6: 42,627,408	L679P	probably damaging	Het
Tnrc6b	T	A	15: 80,880,743	N815K	probably benign	Het
Usp17la	A	T	7: 104,860,350	Q54L	possibly damaging	Het
Vmn2r92	T	A	17: 18,166,774	I125K	probably benign	Het
Xrra1	T	C	7: 99,917,472	Y732H	probably damaging	Het
Zfp131	A	G	13: 119,766,405	S603P	possibly damaging	Het
Zfp28	G	T	7: 6,393,613	S349I	probably benign	Het

Other mutations in Ap2b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Ap2b1	APN	11	83333158	missense	probably damaging	0.99
IGL01583:Ap2b1	APN	11	83324611	missense	possibly damaging	0.61
IGL01753:Ap2b1	APN	11	83321973	missense	probably damaging	1.00
IGL01992:Ap2b1	APN	11	83335530	missense	probably damaging	1.00
IGL02192:Ap2b1	APN	11	83346766	missense	possibly damaging	0.48
IGL02315:Ap2b1	APN	11	83336799	missense	probably damaging	0.96
IGL03235:Ap2b1	APN	11	83341384	missense	probably benign	0.41
P0045:Ap2b1	UTSW	11	83368026	missense	probably damaging	1.00
R0121:Ap2b1	UTSW	11	83321967	missense	possibly damaging	0.66
R0334:Ap2b1	UTSW	11	83367874	splice site	probably benign
R1222:Ap2b1	UTSW	11	83346738	missense	probably benign	0.06
R1297:Ap2b1	UTSW	11	83333109	missense	probably damaging	1.00
R1653:Ap2b1	UTSW	11	83346831	missense	probably damaging	1.00
R1719:Ap2b1	UTSW	11	83324604	missense	probably damaging	1.00
R1885:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1886:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1965:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R1966:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R2046:Ap2b1	UTSW	11	83336386	missense	probably benign	0.14
R2086:Ap2b1	UTSW	11	83351118	missense	possibly damaging	0.88
R2132:Ap2b1	UTSW	11	83324761	splice site	probably benign
R3615:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3616:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3983:Ap2b1	UTSW	11	83390716	missense	probably damaging	1.00
R4124:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4125:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4198:Ap2b1	UTSW	11	83342603	missense	probably damaging	1.00
R4202:Ap2b1	UTSW	11	83335604	critical splice donor site	probably null
R4543:Ap2b1	UTSW	11	83324650	missense	probably damaging	1.00
R4583:Ap2b1	UTSW	11	83397779	missense	probably benign	0.00
R4589:Ap2b1	UTSW	11	83333011	nonsense	probably null
R4916:Ap2b1	UTSW	11	83390706	missense	probably damaging	1.00
R5005:Ap2b1	UTSW	11	83339392	missense	probably damaging	1.00
R5385:Ap2b1	UTSW	11	83342601	missense	probably damaging	1.00
R5510:Ap2b1	UTSW	11	83336737	splice site	probably null
R5738:Ap2b1	UTSW	11	83336430	splice site	probably null
R6023:Ap2b1	UTSW	11	83335398	missense	probably damaging	0.99
R6383:Ap2b1	UTSW	11	83346825	missense	probably damaging	1.00
R6416:Ap2b1	UTSW	11	83308239	start codon destroyed	probably null	1.00
R6502:Ap2b1	UTSW	11	83342679	missense	probably damaging	0.97
R6810:Ap2b1	UTSW	11	83335491	missense	possibly damaging	0.89
R6969:Ap2b1	UTSW	11	83389726	missense	probably damaging	0.99
R7238:Ap2b1	UTSW	11	83333122	missense	possibly damaging	0.91
R7241:Ap2b1	UTSW	11	83351105	missense	probably benign	0.16
R7429:Ap2b1	UTSW	11	83367998	missense	probably benign	0.00
R7588:Ap2b1	UTSW	11	83324522	missense	probably benign	0.00
R7635:Ap2b1	UTSW	11	83389728	missense	probably benign	0.09
R7651:Ap2b1	UTSW	11	83339430	critical splice donor site	probably null
R7753:Ap2b1	UTSW	11	83367907	nonsense	probably null
R8468:Ap2b1	UTSW	11	83351065	missense	probably damaging	1.00
R8943:Ap2b1	UTSW	11	83346753	missense	probably damaging	1.00
R9093:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
R9621:Ap2b1	UTSW	11	83402598	missense	probably damaging	1.00
X0064:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
Z1177:Ap2b1	UTSW	11	83365753	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGTTCCCTGCCCATATCAATCTATG -3'
(R):5'- CGATGAATCCCATGACTCCC -3'

Sequencing Primer
(F):5'- GTTTTAAGTTCCTTGAAACATTAGGC -3'
(R):5'- CAAAAGCATTTGGAGGTTTGTGGTAC -3'

Posted On

2018-03-15