Mutagenetix > Incidental Mutations

Incidental Mutation 'R6269:Tnrc6b'

507248

Institutional Source

Beutler Lab

Gene Symbol

Tnrc6b

Ensembl Gene

ENSMUSG00000047888

Gene Name

trinucleotide repeat containing 6b

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.306) question?

Stock #

R6269 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80711313-80941085 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 80880743 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 815 (N815K)

Ref Sequence

ENSEMBL: ENSMUSP00000064336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067689]

Predicted Effect

probably benign
Transcript: ENSMUST00000067689
AA Change: N815K

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: N815K

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
coiled coil region	33	72	N/A	INTRINSIC
low complexity region	88	106	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC
low complexity region	207	220	N/A	INTRINSIC
low complexity region	242	260	N/A	INTRINSIC
low complexity region	331	346	N/A	INTRINSIC
low complexity region	363	380	N/A	INTRINSIC
low complexity region	416	425	N/A	INTRINSIC
low complexity region	475	487	N/A	INTRINSIC
internal_repeat_1	488	667	6.43e-5	PROSPERO
low complexity region	858	888	N/A	INTRINSIC
Pfam:Ago_hook	955	1095	1.2e-28	PFAM
coiled coil region	1258	1307	N/A	INTRINSIC
Pfam:TNRC6-PABC_bdg	1339	1623	2.8e-112	PFAM
Pfam:RRM_5	1641	1695	2e-7	PFAM
low complexity region	1705	1721	N/A	INTRINSIC
low complexity region	1748	1769	N/A	INTRINSIC
low complexity region	1792	1809	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226857

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227546

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228071

Predicted Effect

unknown
Transcript: ENSMUST00000228124
AA Change: N15K

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228320

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	T	A	6: 86,964,051	I609N	unknown	Het
Ano10	A	T	9: 122,261,242	I277N	probably damaging	Het
Ap2b1	A	G	11: 83,346,673	D483G	probably damaging	Het
As3mt	T	A	19: 46,719,952	F226Y	probably damaging	Het
Atp10a	G	A	7: 58,803,739	R855H	possibly damaging	Het
Bin3	T	A	14: 70,137,162	H213Q	probably benign	Het
Bora	T	C	14: 99,073,667	C512R	probably damaging	Het
Camk2b	T	A	11: 5,978,497	D414V	probably damaging	Het
Ccdc27	A	T	4: 154,037,722	L233Q	unknown	Het
Ccdc73	T	C	2: 104,907,633	S25P	probably damaging	Het
Cenpf	G	A	1: 189,659,920	H572Y	probably benign	Het
Chil4	A	G	3: 106,204,171	V209A	probably damaging	Het
Clstn1	T	C	4: 149,644,067	V650A	probably benign	Het
Cox6a2	T	A	7: 128,206,265	S11C	probably benign	Het
Csf1	T	C	3: 107,749,001	E238G	probably benign	Het
Cyp2c23	T	A	19: 44,029,187	M1L	unknown	Het
Cyp4a10	T	A	4: 115,524,312	M191K	probably damaging	Het
Cyp4a14	A	G	4: 115,491,131	V383A	possibly damaging	Het
D130052B06Rik	T	G	11: 33,623,916	V171G	possibly damaging	Het
Dlgap2	A	G	8: 14,822,369	T617A	probably benign	Het
Dyrk4	T	A	6: 126,886,727	I351F	probably damaging	Het
Epg5	T	C	18: 77,948,370	V94A	probably benign	Het
Fam111a	A	G	19: 12,588,443	T519A	probably benign	Het
Fam208b	C	T	13: 3,581,891	R870H	possibly damaging	Het
Gdpd4	A	G	7: 97,974,462	S314G	probably damaging	Het
Gm9758	T	A	5: 14,912,260	K111N	possibly damaging	Het
Gpr137b	A	T	13: 13,363,511	V285E	probably damaging	Het
Hyls1	G	A	9: 35,561,184	S312F	probably benign	Het
Itgal	T	A	7: 127,330,217	L1102Q	probably null	Het
Kctd19	T	A	8: 105,395,360	Y185F	possibly damaging	Het
Kif5b	A	G	18: 6,223,558	L317P	possibly damaging	Het
Klhl42	C	A	6: 147,092,307	A259E	probably damaging	Het
Lrrc2	A	G	9: 110,980,949	D351G	probably damaging	Het
Med12l	A	G	3: 59,227,822	E797G	probably damaging	Het
Mink1	A	G	11: 70,598,987	E63G	probably damaging	Het
Nek9	T	C	12: 85,332,329		probably null	Het
Olfr1120	A	T	2: 87,846,874	H201L	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Parp6	G	A	9: 59,650,012	V627I	probably benign	Het
Pclo	C	T	5: 14,522,094	Q498*	probably null	Het
Pdlim5	T	C	3: 142,312,325	T170A	possibly damaging	Het
Pgap1	A	T	1: 54,548,008	Y136*	probably null	Het
Pgghg	T	A	7: 140,946,184	N563K	probably damaging	Het
Plxnb2	A	G	15: 89,160,713	M1143T	probably benign	Het
Pnpla1	G	A	17: 28,881,368	G403E	probably benign	Het
Prc1	G	A	7: 80,309,427	R381Q	probably damaging	Het
Psph	A	T	5: 129,766,465	I175N	probably damaging	Het
Rbbp8nl	T	A	2: 180,281,512	K131*	probably null	Het
Rsf1	GGCG	GGCGACGGCCGCG	7: 97,579,906		probably benign	Homo
Sde2	G	A	1: 180,855,806	V42I	probably benign	Het
Slc25a3	G	A	10: 91,117,101	R314*	probably null	Het
Spag9	A	G	11: 94,044,507	N48S	probably benign	Het
Srp54b	T	C	12: 55,255,972	M351T	possibly damaging	Het
Tcaf2	A	G	6: 42,627,408	L679P	probably damaging	Het
Usp17la	A	T	7: 104,860,350	Q54L	possibly damaging	Het
Vmn2r92	T	A	17: 18,166,774	I125K	probably benign	Het
Xrra1	T	C	7: 99,917,472	Y732H	probably damaging	Het
Zfp131	A	G	13: 119,766,405	S603P	possibly damaging	Het
Zfp28	G	T	7: 6,393,613	S349I	probably benign	Het

Other mutations in Tnrc6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01312:Tnrc6b	APN	15	80923578	missense	probably damaging	1.00
IGL01402:Tnrc6b	APN	15	80880544	missense	possibly damaging	0.71
IGL01505:Tnrc6b	APN	15	80879963	missense	probably benign	0.00
IGL01516:Tnrc6b	APN	15	80902622	missense	possibly damaging	0.93
IGL01584:Tnrc6b	APN	15	80879682	missense	probably benign	0.01
IGL01681:Tnrc6b	APN	15	80879311	unclassified	probably null
IGL01909:Tnrc6b	APN	15	80901983	missense	possibly damaging	0.88
IGL01943:Tnrc6b	APN	15	80927695	nonsense	probably null
IGL02253:Tnrc6b	APN	15	80876541	missense	probably damaging	0.99
IGL02260:Tnrc6b	APN	15	80880171	missense	probably damaging	0.99
IGL02437:Tnrc6b	APN	15	80880457	missense	probably damaging	1.00
IGL02541:Tnrc6b	APN	15	80879831	missense	probably benign	0.00
IGL02542:Tnrc6b	APN	15	80902352	missense	possibly damaging	0.83
PIT1430001:Tnrc6b	UTSW	15	80929186	missense	probably damaging	0.99
R0092:Tnrc6b	UTSW	15	80918528	missense	probably damaging	1.00
R0165:Tnrc6b	UTSW	15	80858670	splice site	probably null
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0257:Tnrc6b	UTSW	15	80894355	missense	possibly damaging	0.80
R0418:Tnrc6b	UTSW	15	80913323	missense	probably benign	0.27
R0432:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0487:Tnrc6b	UTSW	15	80880675	missense	probably benign	0.01
R0498:Tnrc6b	UTSW	15	80858719	missense	probably damaging	0.98
R0528:Tnrc6b	UTSW	15	80879403	missense	probably benign	0.00
R0533:Tnrc6b	UTSW	15	80876653	missense	probably benign	0.00
R0571:Tnrc6b	UTSW	15	80913338	missense	probably damaging	1.00
R0650:Tnrc6b	UTSW	15	80784758	missense	probably benign	0.33
R0659:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0884:Tnrc6b	UTSW	15	80902555	small deletion	probably benign
R1131:Tnrc6b	UTSW	15	80894453	missense	possibly damaging	0.45
R1188:Tnrc6b	UTSW	15	80879229	missense	probably benign
R1479:Tnrc6b	UTSW	15	80887032	unclassified	probably null
R1564:Tnrc6b	UTSW	15	80880168	missense	possibly damaging	0.95
R1645:Tnrc6b	UTSW	15	80882958	missense	probably damaging	0.99
R1924:Tnrc6b	UTSW	15	80884206	critical splice acceptor site	probably null
R1926:Tnrc6b	UTSW	15	80881162	missense	probably damaging	1.00
R1928:Tnrc6b	UTSW	15	80880723	missense	probably damaging	1.00
R1965:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R1966:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R2072:Tnrc6b	UTSW	15	80882965	missense	possibly damaging	0.89
R3084:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3552:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3736:Tnrc6b	UTSW	15	80889163	splice site	probably benign
R3791:Tnrc6b	UTSW	15	80923640	missense	probably damaging	1.00
R4170:Tnrc6b	UTSW	15	80916787	missense	probably benign	0.24
R4276:Tnrc6b	UTSW	15	80901971	missense	probably benign	0.42
R4519:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R5380:Tnrc6b	UTSW	15	80879565	missense	possibly damaging	0.56
R5470:Tnrc6b	UTSW	15	80916711	missense	possibly damaging	0.89
R5590:Tnrc6b	UTSW	15	80876502	missense	probably damaging	0.98
R5982:Tnrc6b	UTSW	15	80880816	missense	probably benign
R6331:Tnrc6b	UTSW	15	80879614	missense	probably benign	0.00
R6484:Tnrc6b	UTSW	15	80879324	missense	possibly damaging	0.92
R6622:Tnrc6b	UTSW	15	80879184	missense	probably damaging	0.99
R6695:Tnrc6b	UTSW	15	80879773	missense	probably damaging	1.00
R6728:Tnrc6b	UTSW	15	80918526	missense	probably damaging	1.00
R6776:Tnrc6b	UTSW	15	80924119	missense	possibly damaging	0.87
R7159:Tnrc6b	UTSW	15	80887022	missense	possibly damaging	0.92
R7210:Tnrc6b	UTSW	15	80929285	missense	probably damaging	1.00
R7287:Tnrc6b	UTSW	15	80879541	missense	possibly damaging	0.83
R7402:Tnrc6b	UTSW	15	80884300	missense	probably damaging	1.00
R7453:Tnrc6b	UTSW	15	80902555	small deletion	probably benign
R7479:Tnrc6b	UTSW	15	80889126	missense	probably benign	0.13
R7533:Tnrc6b	UTSW	15	80927741	critical splice donor site	probably null
R7571:Tnrc6b	UTSW	15	80929393	missense	probably benign
R7594:Tnrc6b	UTSW	15	80880307	missense	possibly damaging	0.66
R7831:Tnrc6b	UTSW	15	80880379	missense	possibly damaging	0.49
R7914:Tnrc6b	UTSW	15	80880379	missense	possibly damaging	0.49
X0020:Tnrc6b	UTSW	15	80882997	missense	probably benign	0.16
X0025:Tnrc6b	UTSW	15	80881167	missense	probably benign	0.03
Z1088:Tnrc6b	UTSW	15	80927690	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GATGAAAAGACACCTTCCTCTTGG -3'
(R):5'- TCGAACATTGCCTTGAGGTG -3'

Sequencing Primer
(F):5'- CCTCTTGGAATGAGAGTTCTTGTAAG -3'
(R):5'- GGCCTCCCCATGAACCAG -3'

Posted On

2018-03-15