Mutagenetix > Incidental Mutations

Incidental Mutation 'R6269:Plxnb2'

507249

Institutional Source

Beutler Lab

Gene Symbol

Plxnb2

Ensembl Gene

ENSMUSG00000036606

Gene Name

plexin B2

Synonyms

Debt, 1110007H23Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.942) question?

Stock #

R6269 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

89155549-89180788 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89160713 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 1143 (M1143T)

Ref Sequence

ENSEMBL: ENSMUSP00000104955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]

AlphaFold

B2RXS4

Predicted Effect

probably benign
Transcript: ENSMUST00000060808
AA Change: M1143T

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: M1143T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1275	1809	1.6e-225	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109331
AA Change: M1143T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: M1143T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1274	1809	4.4e-251	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131062

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139372

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143014

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151418

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197760

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229966

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230393

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	T	A	6: 86,964,051	I609N	unknown	Het
Ano10	A	T	9: 122,261,242	I277N	probably damaging	Het
Ap2b1	A	G	11: 83,346,673	D483G	probably damaging	Het
As3mt	T	A	19: 46,719,952	F226Y	probably damaging	Het
Atp10a	G	A	7: 58,803,739	R855H	possibly damaging	Het
Bin3	T	A	14: 70,137,162	H213Q	probably benign	Het
Bora	T	C	14: 99,073,667	C512R	probably damaging	Het
Camk2b	T	A	11: 5,978,497	D414V	probably damaging	Het
Ccdc27	A	T	4: 154,037,722	L233Q	unknown	Het
Ccdc73	T	C	2: 104,907,633	S25P	probably damaging	Het
Cenpf	G	A	1: 189,659,920	H572Y	probably benign	Het
Chil4	A	G	3: 106,204,171	V209A	probably damaging	Het
Clstn1	T	C	4: 149,644,067	V650A	probably benign	Het
Cox6a2	T	A	7: 128,206,265	S11C	probably benign	Het
Csf1	T	C	3: 107,749,001	E238G	probably benign	Het
Cyp2c23	T	A	19: 44,029,187	M1L	unknown	Het
Cyp4a10	T	A	4: 115,524,312	M191K	probably damaging	Het
Cyp4a14	A	G	4: 115,491,131	V383A	possibly damaging	Het
D130052B06Rik	T	G	11: 33,623,916	V171G	possibly damaging	Het
Dlgap2	A	G	8: 14,822,369	T617A	probably benign	Het
Dyrk4	T	A	6: 126,886,727	I351F	probably damaging	Het
Epg5	T	C	18: 77,948,370	V94A	probably benign	Het
Fam111a	A	G	19: 12,588,443	T519A	probably benign	Het
Fam208b	C	T	13: 3,581,891	R870H	possibly damaging	Het
Gdpd4	A	G	7: 97,974,462	S314G	probably damaging	Het
Gm9758	T	A	5: 14,912,260	K111N	possibly damaging	Het
Gpr137b	A	T	13: 13,363,511	V285E	probably damaging	Het
Hyls1	G	A	9: 35,561,184	S312F	probably benign	Het
Itgal	T	A	7: 127,330,217	L1102Q	probably null	Het
Kctd19	T	A	8: 105,395,360	Y185F	possibly damaging	Het
Kif5b	A	G	18: 6,223,558	L317P	possibly damaging	Het
Klhl42	C	A	6: 147,092,307	A259E	probably damaging	Het
Lrrc2	A	G	9: 110,980,949	D351G	probably damaging	Het
Med12l	A	G	3: 59,227,822	E797G	probably damaging	Het
Mink1	A	G	11: 70,598,987	E63G	probably damaging	Het
Nek9	T	C	12: 85,332,329		probably null	Het
Olfr1120	A	T	2: 87,846,874	H201L	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Parp6	G	A	9: 59,650,012	V627I	probably benign	Het
Pclo	C	T	5: 14,522,094	Q498*	probably null	Het
Pdlim5	T	C	3: 142,312,325	T170A	possibly damaging	Het
Pgap1	A	T	1: 54,548,008	Y136*	probably null	Het
Pgghg	T	A	7: 140,946,184	N563K	probably damaging	Het
Pnpla1	G	A	17: 28,881,368	G403E	probably benign	Het
Prc1	G	A	7: 80,309,427	R381Q	probably damaging	Het
Psph	A	T	5: 129,766,465	I175N	probably damaging	Het
Rbbp8nl	T	A	2: 180,281,512	K131*	probably null	Het
Rsf1	GGCG	GGCGACGGCCGCG	7: 97,579,906		probably benign	Homo
Sde2	G	A	1: 180,855,806	V42I	probably benign	Het
Slc25a3	G	A	10: 91,117,101	R314*	probably null	Het
Spag9	A	G	11: 94,044,507	N48S	probably benign	Het
Srp54b	T	C	12: 55,255,972	M351T	possibly damaging	Het
Tcaf2	A	G	6: 42,627,408	L679P	probably damaging	Het
Tnrc6b	T	A	15: 80,880,743	N815K	probably benign	Het
Usp17la	A	T	7: 104,860,350	Q54L	possibly damaging	Het
Vmn2r92	T	A	17: 18,166,774	I125K	probably benign	Het
Xrra1	T	C	7: 99,917,472	Y732H	probably damaging	Het
Zfp131	A	G	13: 119,766,405	S603P	possibly damaging	Het
Zfp28	G	T	7: 6,393,613	S349I	probably benign	Het

Other mutations in Plxnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00546:Plxnb2	APN	15	89162366	splice site	probably benign
IGL01574:Plxnb2	APN	15	89162683	splice site	probably null
IGL01695:Plxnb2	APN	15	89157214	missense	possibly damaging	0.96
IGL01763:Plxnb2	APN	15	89161981	splice site	probably null
IGL01921:Plxnb2	APN	15	89164271	missense	possibly damaging	0.78
IGL02129:Plxnb2	APN	15	89160410	missense	probably benign	0.04
IGL02153:Plxnb2	APN	15	89165813	nonsense	probably null
IGL02637:Plxnb2	APN	15	89164057	missense	possibly damaging	0.53
IGL02892:Plxnb2	APN	15	89161222	critical splice donor site	probably null
IGL03108:Plxnb2	APN	15	89158031	missense	probably benign	0.32
IGL03115:Plxnb2	APN	15	89162438	splice site	probably benign
P0040:Plxnb2	UTSW	15	89162935	missense	probably damaging	1.00
R0022:Plxnb2	UTSW	15	89163276	critical splice donor site	probably null
R0095:Plxnb2	UTSW	15	89165331	missense	probably benign
R0103:Plxnb2	UTSW	15	89161769	missense	possibly damaging	0.85
R0544:Plxnb2	UTSW	15	89158613	splice site	probably benign
R0671:Plxnb2	UTSW	15	89157981	missense	probably benign	0.14
R1279:Plxnb2	UTSW	15	89162321	missense	probably benign	0.02
R1530:Plxnb2	UTSW	15	89167192	missense	probably benign
R1542:Plxnb2	UTSW	15	89165921	missense	probably damaging	1.00
R1610:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
R1686:Plxnb2	UTSW	15	89162462	missense	probably damaging	1.00
R1702:Plxnb2	UTSW	15	89161984	critical splice donor site	probably null
R1996:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R1997:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R2031:Plxnb2	UTSW	15	89162810	nonsense	probably null
R2049:Plxnb2	UTSW	15	89159002	missense	probably damaging	1.00
R2072:Plxnb2	UTSW	15	89158451	missense	probably damaging	1.00
R2076:Plxnb2	UTSW	15	89158026	missense	probably damaging	1.00
R2140:Plxnb2	UTSW	15	89156562	missense	probably benign	0.04
R2418:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R2419:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R3752:Plxnb2	UTSW	15	89157255	splice site	probably benign
R3825:Plxnb2	UTSW	15	89166399	missense	probably benign	0.05
R4154:Plxnb2	UTSW	15	89159642	missense	probably damaging	0.98
R4197:Plxnb2	UTSW	15	89157018	missense	probably damaging	1.00
R4385:Plxnb2	UTSW	15	89160623	missense	probably damaging	0.96
R4434:Plxnb2	UTSW	15	89162803	missense	probably damaging	1.00
R4678:Plxnb2	UTSW	15	89160928	missense	probably benign	0.37
R4717:Plxnb2	UTSW	15	89157419	nonsense	probably null
R4773:Plxnb2	UTSW	15	89166947	missense	probably benign	0.06
R4905:Plxnb2	UTSW	15	89157411	missense	probably damaging	1.00
R5368:Plxnb2	UTSW	15	89159593	missense	possibly damaging	0.94
R5418:Plxnb2	UTSW	15	89166491	missense	probably benign	0.00
R5484:Plxnb2	UTSW	15	89164209	splice site	probably null
R5520:Plxnb2	UTSW	15	89167543	missense	possibly damaging	0.65
R5566:Plxnb2	UTSW	15	89164020	missense	probably benign	0.05
R5568:Plxnb2	UTSW	15	89157435	missense	probably damaging	1.00
R5619:Plxnb2	UTSW	15	89162809	missense	possibly damaging	0.92
R5685:Plxnb2	UTSW	15	89167032	missense	probably damaging	1.00
R5688:Plxnb2	UTSW	15	89158696	missense	probably damaging	1.00
R5809:Plxnb2	UTSW	15	89167571	missense	possibly damaging	0.61
R5813:Plxnb2	UTSW	15	89160759	missense	possibly damaging	0.81
R5866:Plxnb2	UTSW	15	89167572	missense	probably damaging	1.00
R6016:Plxnb2	UTSW	15	89161022	missense	possibly damaging	0.55
R6117:Plxnb2	UTSW	15	89158000	missense	probably benign	0.04
R6187:Plxnb2	UTSW	15	89167258	missense	probably damaging	1.00
R6260:Plxnb2	UTSW	15	89165291	missense	probably benign	0.22
R6263:Plxnb2	UTSW	15	89161986	missense	probably damaging	0.99
R6351:Plxnb2	UTSW	15	89157770	missense	possibly damaging	0.95
R6522:Plxnb2	UTSW	15	89164426	missense	probably benign	0.18
R6856:Plxnb2	UTSW	15	89164320	missense	probably benign	0.27
R6930:Plxnb2	UTSW	15	89160389	missense	probably benign
R7354:Plxnb2	UTSW	15	89165725	missense	possibly damaging	0.92
R7513:Plxnb2	UTSW	15	89158322	critical splice acceptor site	probably null
R7522:Plxnb2	UTSW	15	89161774	missense	probably benign	0.20
R7730:Plxnb2	UTSW	15	89162330	missense	probably benign
R7766:Plxnb2	UTSW	15	89161271	missense	probably benign	0.01
R7781:Plxnb2	UTSW	15	89157022	missense	possibly damaging	0.89
R8126:Plxnb2	UTSW	15	89163303	missense	probably benign
R8131:Plxnb2	UTSW	15	89158713	missense	probably damaging	1.00
R8372:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
R8736:Plxnb2	UTSW	15	89162058	missense	probably damaging	1.00
R8772:Plxnb2	UTSW	15	89162746	missense	probably damaging	1.00
R9022:Plxnb2	UTSW	15	89164268	missense	possibly damaging	0.59
R9253:Plxnb2	UTSW	15	89167812	missense	probably benign
R9398:Plxnb2	UTSW	15	89160919	missense	probably benign	0.02
X0027:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
Z1177:Plxnb2	UTSW	15	89159096	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACCTGTGTGGAAGCTAGG -3'
(R):5'- GGTCAACAAGCTCATCCACG -3'

Sequencing Primer
(F):5'- TCAGCGCAGGCAGGTGTG -3'
(R):5'- ATCCACGCCCGGGTAAGAAG -3'

Posted On

2018-03-15