Incidental Mutation 'R6270:Sema3d'
ID507263
Institutional Source Beutler Lab
Gene Symbol Sema3d
Ensembl Gene ENSMUSG00000040254
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D
Synonyms4631426B19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R6270 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location12383385-12588948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12448107 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 27 (M27L)
Ref Sequence ENSEMBL: ENSMUSP00000142453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030868] [ENSMUST00000197927]
Predicted Effect probably benign
Transcript: ENSMUST00000030868
AA Change: M27L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030868
Gene: ENSMUSG00000040254
AA Change: M27L

DomainStartEndE-ValueType
transmembrane domain 16 35 N/A INTRINSIC
Sema 70 515 2.97e-207 SMART
PSI 533 585 2.03e-13 SMART
IG 598 682 1.39e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196618
Predicted Effect probably benign
Transcript: ENSMUST00000197927
AA Change: M27L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142453
Gene: ENSMUSG00000040254
AA Change: M27L

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Sema 70 515 1e-209 SMART
PSI 533 585 8.5e-16 SMART
Blast:Sema 590 622 1e-9 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin III family of secreted signaling proteins that are involved in axon guidance during neuronal development. The encoded protein contains an N-terminal Sema domain, an immunoglobulin like domain and a C-terminal basic domain. The protein encoded by this gene binds neuropilin and plays an important role in cardiovascular development. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit pulmonary vein connection to the right atrium and atrial septal defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik T C 18: 77,674,421 D65G probably damaging Het
Acsl6 A G 11: 54,352,107 E648G probably benign Het
Ak7 A G 12: 105,768,701 H642R probably benign Het
Akap11 T C 14: 78,518,799 E53G probably damaging Het
Ddr2 T G 1: 169,988,540 T533P probably benign Het
Dhx40 A G 11: 86,799,605 S197P possibly damaging Het
Dolpp1 C A 2: 30,392,269 probably benign Het
Eng A G 2: 32,673,643 D347G probably benign Het
Esrra C T 19: 6,914,120 probably null Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fap T C 2: 62,547,788 I159V probably damaging Het
Fn1 C T 1: 71,637,275 C599Y probably damaging Het
Fnbp4 T C 2: 90,757,463 V395A probably damaging Het
Foxn3 T C 12: 99,388,417 R163G probably damaging Het
Gphn T G 12: 78,522,950 L306R probably benign Het
Gse1 T C 8: 120,569,163 probably benign Het
Habp2 A G 19: 56,306,863 D62G possibly damaging Het
Hdac7 AGGG AGGGG 15: 97,808,495 probably null Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Kit A G 5: 75,609,509 T194A probably benign Het
Krt16 C A 11: 100,247,203 A316S possibly damaging Het
Krt7 A G 15: 101,419,558 D244G probably damaging Het
Lhfpl3 T A 5: 23,273,351 Y77* probably null Het
Lrrc18 A T 14: 33,009,121 M206L probably benign Het
Magel2 C A 7: 62,380,658 C1103* probably null Het
Mcf2l T C 8: 13,018,701 V1058A probably damaging Het
Nbas G A 12: 13,324,293 A541T probably damaging Het
Nrap C T 19: 56,320,198 M1485I probably benign Het
Nudt18 T C 14: 70,579,390 Y145H probably benign Het
Olfr175-ps1 A T 16: 58,824,419 C97S probably damaging Het
Olfr583 T C 7: 103,051,331 L11P probably benign Het
Olfr623 T C 7: 103,660,413 Y279C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb12 A T 18: 37,436,785 Q328L possibly damaging Het
Pde6c T C 19: 38,158,436 W431R probably damaging Het
Pga5 T C 19: 10,674,861 E139G probably benign Het
Pkdrej G T 15: 85,821,105 S210* probably null Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Serinc5 T C 13: 92,688,662 S200P probably damaging Het
Sf3b3 T C 8: 110,841,820 D174G probably damaging Het
Sult1b1 A T 5: 87,517,554 probably null Het
Tcaf3 T C 6: 42,593,791 I342M probably benign Het
Tenm3 G A 8: 48,367,394 T136M probably damaging Het
Tet3 T C 6: 83,375,791 T1008A possibly damaging Het
Tgif1 T C 17: 70,844,866 probably null Het
Trav15-2-dv6-2 A G 14: 53,649,866 D81G probably benign Het
Trpv5 T A 6: 41,674,359 H251L possibly damaging Het
Ttc14 C A 3: 33,800,388 T37K possibly damaging Het
Vmn2r80 A T 10: 79,194,325 I662L probably benign Het
Vmn2r81 A G 10: 79,293,815 I847V probably benign Het
Zfp474 A G 18: 52,638,364 T30A probably benign Het
Zswim4 C T 8: 84,230,951 V163M probably damaging Het
Other mutations in Sema3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Sema3d APN 5 12563222 missense probably benign 0.01
IGL00582:Sema3d APN 5 12585195 missense probably damaging 1.00
IGL00661:Sema3d APN 5 12505839 missense probably damaging 1.00
IGL00780:Sema3d APN 5 12524326 missense probably damaging 1.00
IGL01531:Sema3d APN 5 12541080 missense probably benign
IGL01957:Sema3d APN 5 12563315 missense probably damaging 1.00
IGL02100:Sema3d APN 5 12584991 missense probably benign 0.29
IGL02676:Sema3d APN 5 12570978 missense probably benign 0.38
IGL02749:Sema3d APN 5 12563145 splice site probably benign
IGL02827:Sema3d APN 5 12585118 missense probably benign 0.04
IGL03325:Sema3d APN 5 12463222 missense probably damaging 0.99
R0050:Sema3d UTSW 5 12584953 missense probably benign 0.00
R0085:Sema3d UTSW 5 12570986 missense probably benign 0.00
R0095:Sema3d UTSW 5 12563347 missense probably damaging 1.00
R0157:Sema3d UTSW 5 12508137 missense possibly damaging 0.95
R0328:Sema3d UTSW 5 12448075 missense possibly damaging 0.48
R0924:Sema3d UTSW 5 12463216 missense possibly damaging 0.69
R0930:Sema3d UTSW 5 12463216 missense possibly damaging 0.69
R1609:Sema3d UTSW 5 12541056 missense probably damaging 1.00
R1657:Sema3d UTSW 5 12584974 missense possibly damaging 0.82
R1669:Sema3d UTSW 5 12508084 splice site probably benign
R1795:Sema3d UTSW 5 12584887 missense probably benign 0.02
R1861:Sema3d UTSW 5 12497603 missense probably benign 0.00
R1889:Sema3d UTSW 5 12485021 splice site probably null
R1895:Sema3d UTSW 5 12573843 missense probably damaging 1.00
R1946:Sema3d UTSW 5 12573843 missense probably damaging 1.00
R1975:Sema3d UTSW 5 12563318 missense probably damaging 1.00
R1975:Sema3d UTSW 5 12584998 missense probably benign
R2117:Sema3d UTSW 5 12563273 missense probably benign
R2148:Sema3d UTSW 5 12484959 missense probably damaging 0.99
R2276:Sema3d UTSW 5 12542582 missense possibly damaging 0.63
R3761:Sema3d UTSW 5 12571037 missense probably damaging 1.00
R4063:Sema3d UTSW 5 12585124 missense probably benign 0.25
R4428:Sema3d UTSW 5 12448120 missense probably benign 0.32
R4903:Sema3d UTSW 5 12563158 missense probably benign 0.00
R4999:Sema3d UTSW 5 12508087 splice site probably null
R5000:Sema3d UTSW 5 12448038 missense probably benign 0.01
R5022:Sema3d UTSW 5 12584956 missense probably damaging 1.00
R5186:Sema3d UTSW 5 12584908 missense probably benign
R5584:Sema3d UTSW 5 12566008 missense possibly damaging 0.49
R5584:Sema3d UTSW 5 12570987 missense possibly damaging 0.73
R6368:Sema3d UTSW 5 12571013 missense probably damaging 1.00
R6426:Sema3d UTSW 5 12563264 missense probably damaging 1.00
R6750:Sema3d UTSW 5 12585100 nonsense probably null
R7403:Sema3d UTSW 5 12497584 missense probably damaging 0.97
R7450:Sema3d UTSW 5 12584934 nonsense probably null
R7470:Sema3d UTSW 5 12508185 missense probably damaging 1.00
R7548:Sema3d UTSW 5 12577816 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGCCTTGGCAACCTGTTATC -3'
(R):5'- CTCAGCTATTGTAGACTGTGAAAC -3'

Sequencing Primer
(F):5'- CAGAAAACTTGCTAACTCTAGGAG -3'
(R):5'- CTGTTCAAAGAAGACATTCAGGTGTC -3'
Posted On2018-03-15