Mutagenetix > Incidental Mutation

Incidental Mutation 'R6270:Tcaf3'

507268

Institutional Source

Beutler Lab

Gene Symbol

Tcaf3

Ensembl Gene

ENSMUSG00000018656

Gene Name

TRPM8 channel-associated factor 3

Synonyms

Eapa2, Fam115e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.050) question?

Stock #

R6270 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

42584866-42597692 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 42593791 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 342 (I342M)

Ref Sequence

ENSEMBL: ENSMUSP00000064060 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]

AlphaFold

Q6QR59

Predicted Effect

probably benign
Transcript: ENSMUST00000069023
AA Change: I342M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: I342M

Domain	Start	End	E-Value	Type
internal_repeat_1	26	194	9.98e-16	PROSPERO
low complexity region	210	221	N/A	INTRINSIC
internal_repeat_1	234	402	9.98e-16	PROSPERO
low complexity region	509	518	N/A	INTRINSIC
M60-like	533	832	3.49e-130	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000134707

SMART Domains

Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656

Domain	Start	End	E-Value	Type
low complexity region	210	221	N/A	INTRINSIC

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.6%

Validation Efficiency

98% (51/52)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030462N17Rik	T	C	18: 77,674,421	D65G	probably damaging	Het
Acsl6	A	G	11: 54,352,107	E648G	probably benign	Het
Ak7	A	G	12: 105,768,701	H642R	probably benign	Het
Akap11	T	C	14: 78,518,799	E53G	probably damaging	Het
Ddr2	T	G	1: 169,988,540	T533P	probably benign	Het
Dhx40	A	G	11: 86,799,605	S197P	possibly damaging	Het
Dolpp1	C	A	2: 30,392,269		probably benign	Het
Eng	A	G	2: 32,673,643	D347G	probably benign	Het
Esrra	C	T	19: 6,914,120		probably null	Het
Fam208b	C	T	13: 3,581,891	R870H	possibly damaging	Het
Fap	T	C	2: 62,547,788	I159V	probably damaging	Het
Fn1	C	T	1: 71,637,275	C599Y	probably damaging	Het
Fnbp4	T	C	2: 90,757,463	V395A	probably damaging	Het
Foxn3	T	C	12: 99,388,417	R163G	probably damaging	Het
Gphn	T	G	12: 78,522,950	L306R	probably benign	Het
Gse1	T	C	8: 120,569,163		probably benign	Het
Habp2	A	G	19: 56,306,863	D62G	possibly damaging	Het
Hdac7	AGGG	AGGGG	15: 97,808,495		probably null	Het
Hyls1	G	A	9: 35,561,184	S312F	probably benign	Het
Kit	A	G	5: 75,609,509	T194A	probably benign	Het
Krt16	C	A	11: 100,247,203	A316S	possibly damaging	Het
Krt7	A	G	15: 101,419,558	D244G	probably damaging	Het
Lhfpl3	T	A	5: 23,273,351	Y77*	probably null	Het
Lrrc18	A	T	14: 33,009,121	M206L	probably benign	Het
Magel2	C	A	7: 62,380,658	C1103*	probably null	Het
Mcf2l	T	C	8: 13,018,701	V1058A	probably damaging	Het
Nbas	G	A	12: 13,324,293	A541T	probably damaging	Het
Nrap	C	T	19: 56,320,198	M1485I	probably benign	Het
Nudt18	T	C	14: 70,579,390	Y145H	probably benign	Het
Olfr175-ps1	A	T	16: 58,824,419	C97S	probably damaging	Het
Olfr583	T	C	7: 103,051,331	L11P	probably benign	Het
Olfr623	T	C	7: 103,660,413	Y279C	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pcdhb12	A	T	18: 37,436,785	Q328L	possibly damaging	Het
Pde6c	T	C	19: 38,158,436	W431R	probably damaging	Het
Pga5	T	C	19: 10,674,861	E139G	probably benign	Het
Pkdrej	G	T	15: 85,821,105	S210*	probably null	Het
Pnpla1	G	A	17: 28,881,368	G403E	probably benign	Het
Sema3d	A	T	5: 12,448,107	M27L	probably benign	Het
Serinc5	T	C	13: 92,688,662	S200P	probably damaging	Het
Sf3b3	T	C	8: 110,841,820	D174G	probably damaging	Het
Sult1b1	A	T	5: 87,517,554		probably null	Het
Tenm3	G	A	8: 48,367,394	T136M	probably damaging	Het
Tet3	T	C	6: 83,375,791	T1008A	possibly damaging	Het
Tgif1	T	C	17: 70,844,866		probably null	Het
Trav15-2-dv6-2	A	G	14: 53,649,866	D81G	probably benign	Het
Trpv5	T	A	6: 41,674,359	H251L	possibly damaging	Het
Ttc14	C	A	3: 33,800,388	T37K	possibly damaging	Het
Vmn2r80	A	T	10: 79,194,325	I662L	probably benign	Het
Vmn2r81	A	G	10: 79,293,815	I847V	probably benign	Het
Zfp474	A	G	18: 52,638,364	T30A	probably benign	Het
Zswim4	C	T	8: 84,230,951	V163M	probably damaging	Het

Other mutations in Tcaf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Tcaf3	APN	6	42593385	missense	probably benign	0.14
IGL00931:Tcaf3	APN	6	42597228	missense	probably benign	0.16
IGL01391:Tcaf3	APN	6	42593681	missense	probably damaging	1.00
IGL01804:Tcaf3	APN	6	42597129	missense	probably damaging	1.00
IGL02272:Tcaf3	APN	6	42596660	missense	probably damaging	0.98
IGL02934:Tcaf3	APN	6	42593898	missense	probably benign	0.00
IGL03258:Tcaf3	APN	6	42589839	missense	probably damaging	1.00
defused	UTSW	6	42596933	missense	probably benign	0.03
R0116:Tcaf3	UTSW	6	42591350	missense	probably benign	0.12
R0135:Tcaf3	UTSW	6	42589758	missense	probably benign
R0357:Tcaf3	UTSW	6	42589827	missense	probably damaging	0.98
R0526:Tcaf3	UTSW	6	42589804	missense	probably damaging	1.00
R0592:Tcaf3	UTSW	6	42596843	missense	probably benign	0.16
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1902:Tcaf3	UTSW	6	42593552	missense	possibly damaging	0.83
R1912:Tcaf3	UTSW	6	42596688	missense	possibly damaging	0.59
R2020:Tcaf3	UTSW	6	42593724	missense	possibly damaging	0.66
R2238:Tcaf3	UTSW	6	42593328	missense	probably benign	0.00
R2259:Tcaf3	UTSW	6	42591430	missense	possibly damaging	0.53
R2436:Tcaf3	UTSW	6	42593729	missense	probably damaging	1.00
R3005:Tcaf3	UTSW	6	42594044	missense	probably damaging	1.00
R3402:Tcaf3	UTSW	6	42593853	missense	probably benign	0.08
R3753:Tcaf3	UTSW	6	42589804	missense	probably damaging	1.00
R3799:Tcaf3	UTSW	6	42597080	missense	probably damaging	1.00
R4515:Tcaf3	UTSW	6	42589996	missense	probably damaging	1.00
R4640:Tcaf3	UTSW	6	42587579	missense	probably damaging	0.96
R4688:Tcaf3	UTSW	6	42593366	splice site	probably null
R4904:Tcaf3	UTSW	6	42593997	nonsense	probably null
R5030:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5031:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5045:Tcaf3	UTSW	6	42593684	missense	possibly damaging	0.55
R5105:Tcaf3	UTSW	6	42591325	missense	probably damaging	1.00
R5139:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5187:Tcaf3	UTSW	6	42597020	missense	possibly damaging	0.51
R5196:Tcaf3	UTSW	6	42593715	missense	probably benign	0.00
R5213:Tcaf3	UTSW	6	42591467	missense	probably damaging	1.00
R5296:Tcaf3	UTSW	6	42587510	missense	possibly damaging	0.55
R5402:Tcaf3	UTSW	6	42591926	missense	probably benign	0.12
R5425:Tcaf3	UTSW	6	42596763	missense	probably damaging	1.00
R5431:Tcaf3	UTSW	6	42597185	missense	probably damaging	1.00
R5601:Tcaf3	UTSW	6	42587528	missense	possibly damaging	0.90
R5839:Tcaf3	UTSW	6	42593849	missense	possibly damaging	0.55
R5865:Tcaf3	UTSW	6	42596697	missense	probably benign	0.07
R6005:Tcaf3	UTSW	6	42589971	missense	probably benign	0.19
R6341:Tcaf3	UTSW	6	42597259	missense	possibly damaging	0.55
R6344:Tcaf3	UTSW	6	42597171	missense	possibly damaging	0.48
R6521:Tcaf3	UTSW	6	42593238	missense	probably damaging	0.99
R6589:Tcaf3	UTSW	6	42594061	missense	possibly damaging	0.55
R6981:Tcaf3	UTSW	6	42597125	missense	probably damaging	1.00
R7155:Tcaf3	UTSW	6	42593891	missense	probably benign
R7185:Tcaf3	UTSW	6	42593930	missense	probably benign	0.01
R7262:Tcaf3	UTSW	6	42593801	missense	probably damaging	0.97
R7340:Tcaf3	UTSW	6	42589914	missense	probably benign	0.08
R7421:Tcaf3	UTSW	6	42596842	missense	probably benign	0.02
R7690:Tcaf3	UTSW	6	42597135	missense	probably damaging	1.00
R7850:Tcaf3	UTSW	6	42594206	splice site	probably null
R7909:Tcaf3	UTSW	6	42591964	missense	possibly damaging	0.92
R9419:Tcaf3	UTSW	6	42596782	missense	probably benign	0.00
R9440:Tcaf3	UTSW	6	42596972	nonsense	probably null
R9469:Tcaf3	UTSW	6	42596894	missense	probably benign	0.00
R9668:Tcaf3	UTSW	6	42589702	missense	probably damaging	1.00
R9787:Tcaf3	UTSW	6	42597090	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAGTGATAGTTTGTCCCTTCAGG -3'
(R):5'- CAAACTATGCTGCCATTTGTGC -3'

Sequencing Primer
(F):5'- AATGGGAAACTGCCTCGCTG -3'
(R):5'- CTTAATGCTTTACACTGGCTGATG -3'

Posted On

2018-03-15