Incidental Mutation 'R6270:Olfr583'
ID507271
Institutional Source Beutler Lab
Gene Symbol Olfr583
Ensembl Gene ENSMUSG00000073960
Gene Nameolfactory receptor 583
SynonymsMOR14-6, GA_x6K02T2PBJ9-5762668-5763618
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R6270 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103051300-103052259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103051331 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 11 (L11P)
Ref Sequence ENSEMBL: ENSMUSP00000095812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098211]
Predicted Effect probably benign
Transcript: ENSMUST00000098211
AA Change: L11P

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095812
Gene: ENSMUSG00000073960
AA Change: L11P

DomainStartEndE-ValueType
Pfam:7tm_4 40 319 9.1e-107 PFAM
Pfam:7TM_GPCR_Srsx 45 316 1.4e-5 PFAM
Pfam:7tm_1 50 301 9.6e-20 PFAM
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik T C 18: 77,674,421 D65G probably damaging Het
Acsl6 A G 11: 54,352,107 E648G probably benign Het
Ak7 A G 12: 105,768,701 H642R probably benign Het
Akap11 T C 14: 78,518,799 E53G probably damaging Het
Ddr2 T G 1: 169,988,540 T533P probably benign Het
Dhx40 A G 11: 86,799,605 S197P possibly damaging Het
Dolpp1 C A 2: 30,392,269 probably benign Het
Eng A G 2: 32,673,643 D347G probably benign Het
Esrra C T 19: 6,914,120 probably null Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fap T C 2: 62,547,788 I159V probably damaging Het
Fn1 C T 1: 71,637,275 C599Y probably damaging Het
Fnbp4 T C 2: 90,757,463 V395A probably damaging Het
Foxn3 T C 12: 99,388,417 R163G probably damaging Het
Gphn T G 12: 78,522,950 L306R probably benign Het
Gse1 T C 8: 120,569,163 probably benign Het
Habp2 A G 19: 56,306,863 D62G possibly damaging Het
Hdac7 AGGG AGGGG 15: 97,808,495 probably null Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Kit A G 5: 75,609,509 T194A probably benign Het
Krt16 C A 11: 100,247,203 A316S possibly damaging Het
Krt7 A G 15: 101,419,558 D244G probably damaging Het
Lhfpl3 T A 5: 23,273,351 Y77* probably null Het
Lrrc18 A T 14: 33,009,121 M206L probably benign Het
Magel2 C A 7: 62,380,658 C1103* probably null Het
Mcf2l T C 8: 13,018,701 V1058A probably damaging Het
Nbas G A 12: 13,324,293 A541T probably damaging Het
Nrap C T 19: 56,320,198 M1485I probably benign Het
Nudt18 T C 14: 70,579,390 Y145H probably benign Het
Olfr175-ps1 A T 16: 58,824,419 C97S probably damaging Het
Olfr623 T C 7: 103,660,413 Y279C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb12 A T 18: 37,436,785 Q328L possibly damaging Het
Pde6c T C 19: 38,158,436 W431R probably damaging Het
Pga5 T C 19: 10,674,861 E139G probably benign Het
Pkdrej G T 15: 85,821,105 S210* probably null Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Sema3d A T 5: 12,448,107 M27L probably benign Het
Serinc5 T C 13: 92,688,662 S200P probably damaging Het
Sf3b3 T C 8: 110,841,820 D174G probably damaging Het
Sult1b1 A T 5: 87,517,554 probably null Het
Tcaf3 T C 6: 42,593,791 I342M probably benign Het
Tenm3 G A 8: 48,367,394 T136M probably damaging Het
Tet3 T C 6: 83,375,791 T1008A possibly damaging Het
Tgif1 T C 17: 70,844,866 probably null Het
Trav15-2-dv6-2 A G 14: 53,649,866 D81G probably benign Het
Trpv5 T A 6: 41,674,359 H251L possibly damaging Het
Ttc14 C A 3: 33,800,388 T37K possibly damaging Het
Vmn2r80 A T 10: 79,194,325 I662L probably benign Het
Vmn2r81 A G 10: 79,293,815 I847V probably benign Het
Zfp474 A G 18: 52,638,364 T30A probably benign Het
Zswim4 C T 8: 84,230,951 V163M probably damaging Het
Other mutations in Olfr583
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02172:Olfr583 APN 7 103051375 missense probably benign 0.02
IGL02200:Olfr583 APN 7 103051793 missense probably benign
IGL02412:Olfr583 APN 7 103052152 missense probably benign 0.01
IGL02452:Olfr583 APN 7 103051931 missense probably benign 0.00
IGL02859:Olfr583 APN 7 103052138 missense probably benign 0.00
IGL03078:Olfr583 APN 7 103051829 missense probably damaging 1.00
R0675:Olfr583 UTSW 7 103051702 missense probably benign 0.22
R1474:Olfr583 UTSW 7 103052081 missense probably damaging 1.00
R1531:Olfr583 UTSW 7 103051588 missense probably benign 0.00
R1535:Olfr583 UTSW 7 103051369 missense probably benign 0.14
R1777:Olfr583 UTSW 7 103051376 missense probably benign 0.41
R1883:Olfr583 UTSW 7 103051982 missense probably benign 0.00
R1884:Olfr583 UTSW 7 103051982 missense probably benign 0.00
R2265:Olfr583 UTSW 7 103052137 missense probably benign 0.00
R2267:Olfr583 UTSW 7 103052137 missense probably benign 0.00
R2269:Olfr583 UTSW 7 103052137 missense probably benign 0.00
R2299:Olfr583 UTSW 7 103051582 missense probably damaging 0.99
R3802:Olfr583 UTSW 7 103052165 missense probably benign 0.05
R4239:Olfr583 UTSW 7 103051796 missense probably benign 0.17
R4426:Olfr583 UTSW 7 103051811 missense probably damaging 1.00
R5335:Olfr583 UTSW 7 103051535 missense probably damaging 1.00
R6048:Olfr583 UTSW 7 103051319 missense probably benign 0.00
R6837:Olfr583 UTSW 7 103051722 nonsense probably null
R7257:Olfr583 UTSW 7 103051630 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AGTCTCTCACACTGGAAGATTC -3'
(R):5'- ACATAGGTTCATGCAGGCTATG -3'

Sequencing Primer
(F):5'- CTCTCACACTGGAAGATTCTTATTG -3'
(R):5'- CAGGCTATGCTGGGTCACAATG -3'
Posted On2018-03-15