Mutagenetix > Incidental Mutations

Incidental Mutation 'R6270:Tenm3'

507274

Institutional Source

Beutler Lab

Gene Symbol

Tenm3

Ensembl Gene

ENSMUSG00000031561

Gene Name

teneurin transmembrane protein 3

Synonyms

Ten-m3, Odz3, 2610100B16Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.606) question?

Stock #

R6270 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

48227682-48843951 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 48367394 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 136 (T136M)

Ref Sequence

ENSEMBL: ENSMUSP00000148613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000110346] [ENSMUST00000190840] [ENSMUST00000211976]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033965
AA Change: T343M

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: T343M

Domain	Start	End	E-Value	Type
Pfam:Ten_N	11	177	6.9e-91	PFAM
Pfam:Ten_N	171	308	1e-72	PFAM
transmembrane domain	309	331	N/A	INTRINSIC
EGF	517	545	2.32e-1	SMART
EGF_like	548	576	4.11e1	SMART
EGF	581	610	1.69e1	SMART
EGF	613	642	1.35e-2	SMART
EGF	647	677	6.11e-1	SMART
EGF	680	708	7.95e0	SMART
EGF	711	739	1.28e1	SMART
EGF	751	783	1.64e-1	SMART
PDB:1RWL\|A	1276	1511	9e-6	PDB
low complexity region	2593	2602	N/A	INTRINSIC
Pfam:Tox-GHH	2631	2708	1.5e-34	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110346
AA Change: T71M

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105975
Gene: ENSMUSG00000031561
AA Change: T71M

Domain	Start	End	E-Value	Type
Pfam:Ten_N	1	36	1.1e-14	PFAM
transmembrane domain	37	59	N/A	INTRINSIC
EGF	245	273	2.32e-1	SMART
EGF_like	276	304	4.11e1	SMART
EGF	309	338	1.69e1	SMART
EGF	341	370	1.35e-2	SMART
EGF	375	405	6.11e-1	SMART
EGF	408	436	7.95e0	SMART
EGF	439	467	1.28e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000190840
AA Change: T343M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: T343M

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	182	7.6e-77	PFAM
Pfam:Ten_N	168	308	6.6e-50	PFAM
transmembrane domain	309	331	N/A	INTRINSIC
EGF	517	545	2.32e-1	SMART
EGF_like	548	576	4.11e1	SMART
EGF	581	610	1.69e1	SMART
EGF	613	642	1.35e-2	SMART
EGF	647	677	6.11e-1	SMART
EGF	680	708	7.95e0	SMART
EGF	711	739	1.28e1	SMART
EGF	751	783	1.64e-1	SMART
PDB:1RWL\|A	1276	1511	9e-6	PDB
low complexity region	2593	2602	N/A	INTRINSIC
Pfam:Tox-GHH	2630	2708	3.2e-35	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000211976
AA Change: T136M

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.6%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030462N17Rik	T	C	18: 77,674,421	D65G	probably damaging	Het
Acsl6	A	G	11: 54,352,107	E648G	probably benign	Het
Ak7	A	G	12: 105,768,701	H642R	probably benign	Het
Akap11	T	C	14: 78,518,799	E53G	probably damaging	Het
Ddr2	T	G	1: 169,988,540	T533P	probably benign	Het
Dhx40	A	G	11: 86,799,605	S197P	possibly damaging	Het
Dolpp1	C	A	2: 30,392,269		probably benign	Het
Eng	A	G	2: 32,673,643	D347G	probably benign	Het
Esrra	C	T	19: 6,914,120		probably null	Het
Fam208b	C	T	13: 3,581,891	R870H	possibly damaging	Het
Fap	T	C	2: 62,547,788	I159V	probably damaging	Het
Fn1	C	T	1: 71,637,275	C599Y	probably damaging	Het
Fnbp4	T	C	2: 90,757,463	V395A	probably damaging	Het
Foxn3	T	C	12: 99,388,417	R163G	probably damaging	Het
Gphn	T	G	12: 78,522,950	L306R	probably benign	Het
Gse1	T	C	8: 120,569,163		probably benign	Het
Habp2	A	G	19: 56,306,863	D62G	possibly damaging	Het
Hdac7	AGGG	AGGGG	15: 97,808,495		probably null	Het
Hyls1	G	A	9: 35,561,184	S312F	probably benign	Het
Kit	A	G	5: 75,609,509	T194A	probably benign	Het
Krt16	C	A	11: 100,247,203	A316S	possibly damaging	Het
Krt7	A	G	15: 101,419,558	D244G	probably damaging	Het
Lhfpl3	T	A	5: 23,273,351	Y77*	probably null	Het
Lrrc18	A	T	14: 33,009,121	M206L	probably benign	Het
Magel2	C	A	7: 62,380,658	C1103*	probably null	Het
Mcf2l	T	C	8: 13,018,701	V1058A	probably damaging	Het
Nbas	G	A	12: 13,324,293	A541T	probably damaging	Het
Nrap	C	T	19: 56,320,198	M1485I	probably benign	Het
Nudt18	T	C	14: 70,579,390	Y145H	probably benign	Het
Olfr175-ps1	A	T	16: 58,824,419	C97S	probably damaging	Het
Olfr583	T	C	7: 103,051,331	L11P	probably benign	Het
Olfr623	T	C	7: 103,660,413	Y279C	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pcdhb12	A	T	18: 37,436,785	Q328L	possibly damaging	Het
Pde6c	T	C	19: 38,158,436	W431R	probably damaging	Het
Pga5	T	C	19: 10,674,861	E139G	probably benign	Het
Pkdrej	G	T	15: 85,821,105	S210*	probably null	Het
Pnpla1	G	A	17: 28,881,368	G403E	probably benign	Het
Sema3d	A	T	5: 12,448,107	M27L	probably benign	Het
Serinc5	T	C	13: 92,688,662	S200P	probably damaging	Het
Sf3b3	T	C	8: 110,841,820	D174G	probably damaging	Het
Sult1b1	A	T	5: 87,517,554		probably null	Het
Tcaf3	T	C	6: 42,593,791	I342M	probably benign	Het
Tet3	T	C	6: 83,375,791	T1008A	possibly damaging	Het
Tgif1	T	C	17: 70,844,866		probably null	Het
Trav15-2-dv6-2	A	G	14: 53,649,866	D81G	probably benign	Het
Trpv5	T	A	6: 41,674,359	H251L	possibly damaging	Het
Ttc14	C	A	3: 33,800,388	T37K	possibly damaging	Het
Vmn2r80	A	T	10: 79,194,325	I662L	probably benign	Het
Vmn2r81	A	G	10: 79,293,815	I847V	probably benign	Het
Zfp474	A	G	18: 52,638,364	T30A	probably benign	Het
Zswim4	C	T	8: 84,230,951	V163M	probably damaging	Het

Other mutations in Tenm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Tenm3	APN	8	48417060	missense	probably damaging	1.00
IGL00538:Tenm3	APN	8	48236025	missense	probably damaging	1.00
IGL00719:Tenm3	APN	8	48279042	missense	probably benign	0.39
IGL00720:Tenm3	APN	8	48276421	missense	probably damaging	0.98
IGL00870:Tenm3	APN	8	48417132	missense	probably benign	0.00
IGL00976:Tenm3	APN	8	48256841	missense	probably benign	0.14
IGL01469:Tenm3	APN	8	48236423	missense	probably damaging	1.00
IGL01508:Tenm3	APN	8	48276645	missense	probably benign	0.09
IGL01590:Tenm3	APN	8	48228802	missense	probably damaging	1.00
IGL01610:Tenm3	APN	8	48254477	missense	probably damaging	1.00
IGL01874:Tenm3	APN	8	48236758	nonsense	probably null
IGL01892:Tenm3	APN	8	48276396	missense	probably benign	0.09
IGL02098:Tenm3	APN	8	48276576	missense	possibly damaging	0.94
IGL02382:Tenm3	APN	8	48235476	missense	probably damaging	1.00
IGL02397:Tenm3	APN	8	48236694	missense	possibly damaging	0.94
IGL02475:Tenm3	APN	8	48279198	splice site	probably benign
IGL02502:Tenm3	APN	8	48288016	missense	probably damaging	1.00
IGL02508:Tenm3	APN	8	48299639	missense	probably benign	0.30
IGL02543:Tenm3	APN	8	48298956	missense	probably damaging	1.00
IGL02723:Tenm3	APN	8	48276903	missense	probably benign	0.02
IGL03037:Tenm3	APN	8	48298878	missense	possibly damaging	0.90
IGL03160:Tenm3	APN	8	48646418	missense	probably benign	0.05
IGL03268:Tenm3	APN	8	48235523	missense	probably damaging	1.00
IGL02988:Tenm3	UTSW	8	48235346	missense	probably damaging	0.99
PIT4431001:Tenm3	UTSW	8	48235607	missense	probably damaging	1.00
PIT4504001:Tenm3	UTSW	8	48293657	missense	probably damaging	1.00
R0079:Tenm3	UTSW	8	48343345	missense	possibly damaging	0.90
R0121:Tenm3	UTSW	8	48342659	missense	probably damaging	0.99
R0123:Tenm3	UTSW	8	48674472	missense	probably damaging	1.00
R0134:Tenm3	UTSW	8	48674472	missense	probably damaging	1.00
R0147:Tenm3	UTSW	8	48236720	missense	probably damaging	1.00
R0148:Tenm3	UTSW	8	48236720	missense	probably damaging	1.00
R0309:Tenm3	UTSW	8	48341034	missense	probably damaging	1.00
R0322:Tenm3	UTSW	8	48236912	splice site	probably benign
R0335:Tenm3	UTSW	8	48232105	missense	probably damaging	1.00
R0355:Tenm3	UTSW	8	48228975	missense	probably damaging	1.00
R0411:Tenm3	UTSW	8	48287791	missense	possibly damaging	0.61
R0505:Tenm3	UTSW	8	48341160	splice site	probably benign
R0573:Tenm3	UTSW	8	48674399	splice site	probably benign
R0599:Tenm3	UTSW	8	48277710	missense	probably damaging	1.00
R0616:Tenm3	UTSW	8	48276156	missense	possibly damaging	0.76
R0637:Tenm3	UTSW	8	48236525	missense	probably damaging	1.00
R0726:Tenm3	UTSW	8	48236594	missense	probably damaging	1.00
R0840:Tenm3	UTSW	8	48335742	missense	probably damaging	0.99
R0981:Tenm3	UTSW	8	48298965	missense	probably damaging	1.00
R1006:Tenm3	UTSW	8	48228542	missense	probably damaging	1.00
R1199:Tenm3	UTSW	8	48235582	missense	probably damaging	0.99
R1223:Tenm3	UTSW	8	48240396	missense	possibly damaging	0.72
R1240:Tenm3	UTSW	8	48287893	missense	possibly damaging	0.74
R1394:Tenm3	UTSW	8	48276400	missense	probably benign
R1455:Tenm3	UTSW	8	48279048	missense	possibly damaging	0.87
R1459:Tenm3	UTSW	8	48235971	missense	probably damaging	1.00
R1473:Tenm3	UTSW	8	48310625	missense	probably damaging	1.00
R1501:Tenm3	UTSW	8	48343316	missense	probably damaging	0.99
R1507:Tenm3	UTSW	8	48287822	missense	probably benign	0.01
R1522:Tenm3	UTSW	8	48395576	missense	probably damaging	1.00
R1524:Tenm3	UTSW	8	48228981	missense	possibly damaging	0.92
R1553:Tenm3	UTSW	8	48236421	missense	probably damaging	1.00
R1572:Tenm3	UTSW	8	48228993	missense	possibly damaging	0.94
R1583:Tenm3	UTSW	8	48279074	missense	probably benign	0.09
R1676:Tenm3	UTSW	8	48417119	missense	possibly damaging	0.83
R1732:Tenm3	UTSW	8	48310634	missense	probably damaging	1.00
R1768:Tenm3	UTSW	8	48232104	missense	probably damaging	1.00
R1777:Tenm3	UTSW	8	48417179	missense	probably benign	0.05
R1793:Tenm3	UTSW	8	48674544	missense	probably damaging	0.98
R1801:Tenm3	UTSW	8	48276256	missense	probably benign	0.39
R1863:Tenm3	UTSW	8	48276346	missense	probably benign	0.20
R1898:Tenm3	UTSW	8	48310761	missense	probably damaging	1.00
R1971:Tenm3	UTSW	8	48236313	missense	probably damaging	1.00
R1972:Tenm3	UTSW	8	48228591	missense	probably damaging	1.00
R1996:Tenm3	UTSW	8	48228668	missense	probably damaging	1.00
R2061:Tenm3	UTSW	8	48342256	critical splice donor site	probably null
R2109:Tenm3	UTSW	8	48343349	missense	possibly damaging	0.94
R2124:Tenm3	UTSW	8	48417006	critical splice donor site	probably null
R2190:Tenm3	UTSW	8	48395544	missense	probably damaging	1.00
R2204:Tenm3	UTSW	8	48674550	missense	probably benign	0.17
R2233:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2234:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2235:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2237:Tenm3	UTSW	8	48342337	missense	probably damaging	1.00
R2418:Tenm3	UTSW	8	48276658	missense	possibly damaging	0.87
R2419:Tenm3	UTSW	8	48276658	missense	possibly damaging	0.87
R2435:Tenm3	UTSW	8	48287953	missense	probably damaging	1.00
R2483:Tenm3	UTSW	8	48240270	missense	probably damaging	0.99
R3406:Tenm3	UTSW	8	48228555	missense	probably damaging	1.00
R3724:Tenm3	UTSW	8	48277746	missense	probably damaging	0.97
R4009:Tenm3	UTSW	8	48349223	missense	probably damaging	1.00
R4210:Tenm3	UTSW	8	48349404	missense	probably damaging	1.00
R4293:Tenm3	UTSW	8	48395658	missense	probably damaging	1.00
R4656:Tenm3	UTSW	8	48293726	missense	probably damaging	1.00
R4663:Tenm3	UTSW	8	48235970	missense	probably damaging	1.00
R4835:Tenm3	UTSW	8	48313236	critical splice donor site	probably null
R4851:Tenm3	UTSW	8	48310621	critical splice donor site	probably null
R4867:Tenm3	UTSW	8	48235821	missense	probably damaging	1.00
R4892:Tenm3	UTSW	8	48276861	missense	probably damaging	0.99
R4895:Tenm3	UTSW	8	48300971	missense	probably damaging	1.00
R4962:Tenm3	UTSW	8	48278961	nonsense	probably null
R4995:Tenm3	UTSW	8	48229137	missense	possibly damaging	0.87
R4996:Tenm3	UTSW	8	48235826	missense	probably damaging	0.97
R5091:Tenm3	UTSW	8	48342308	missense	probably benign	0.14
R5228:Tenm3	UTSW	8	48236355	missense	probably damaging	1.00
R5253:Tenm3	UTSW	8	48229198	missense	possibly damaging	0.92
R5260:Tenm3	UTSW	8	48236855	missense	probably damaging	1.00
R5363:Tenm3	UTSW	8	48287831	missense	possibly damaging	0.55
R5414:Tenm3	UTSW	8	48236355	missense	probably damaging	1.00
R5427:Tenm3	UTSW	8	48236564	missense	probably damaging	1.00
R5431:Tenm3	UTSW	8	48367377	nonsense	probably null
R5566:Tenm3	UTSW	8	48279006	missense	probably damaging	1.00
R5579:Tenm3	UTSW	8	48236764	missense	probably damaging	1.00
R5656:Tenm3	UTSW	8	48228762	missense	probably damaging	1.00
R5931:Tenm3	UTSW	8	48646498	missense	probably benign	0.00
R5959:Tenm3	UTSW	8	48646447	nonsense	probably null
R5965:Tenm3	UTSW	8	48228508	nonsense	probably null
R6062:Tenm3	UTSW	8	48343406	missense	possibly damaging	0.46
R6151:Tenm3	UTSW	8	48395573	missense	probably damaging	1.00
R6157:Tenm3	UTSW	8	48298808	missense	probably damaging	0.96
R6167:Tenm3	UTSW	8	48254622	missense	possibly damaging	0.46
R6217:Tenm3	UTSW	8	48293665	missense	probably damaging	0.99
R6233:Tenm3	UTSW	8	48417059	missense	probably damaging	1.00
R6329:Tenm3	UTSW	8	48276849	missense	probably damaging	0.99
R6466:Tenm3	UTSW	8	48236063	missense	probably damaging	0.97
R6515:Tenm3	UTSW	8	48417222	missense	probably benign
R6516:Tenm3	UTSW	8	48417222	missense	probably benign
R6747:Tenm3	UTSW	8	48343243	missense	probably damaging	1.00
R6782:Tenm3	UTSW	8	48646256	critical splice donor site	probably null
R6788:Tenm3	UTSW	8	48674493	missense	probably damaging	1.00
R6823:Tenm3	UTSW	8	48256837	missense	probably damaging	0.99
R6846:Tenm3	UTSW	8	48276738	missense	probably benign	0.39
R6913:Tenm3	UTSW	8	48298937	missense	probably damaging	0.99
R6941:Tenm3	UTSW	8	48674416	missense	probably damaging	0.99
R6950:Tenm3	UTSW	8	48240479	nonsense	probably null
R6968:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R6970:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R6993:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R7003:Tenm3	UTSW	8	48240444	missense	probably damaging	1.00
R7125:Tenm3	UTSW	8	48674553	missense	probably benign	0.00
R7140:Tenm3	UTSW	8	48292236	missense	probably damaging	1.00
R7222:Tenm3	UTSW	8	48300969	missense	probably damaging	1.00
R7232:Tenm3	UTSW	8	48235935	missense	probably damaging	1.00
R7336:Tenm3	UTSW	8	48236177	missense	possibly damaging	0.93
R7417:Tenm3	UTSW	8	48236183	missense	probably damaging	1.00
R7526:Tenm3	UTSW	8	48287812	missense	probably damaging	0.96
R7527:Tenm3	UTSW	8	48276600	missense	possibly damaging	0.60
R7616:Tenm3	UTSW	8	48341049	missense	possibly damaging	0.56
R7662:Tenm3	UTSW	8	48335727	missense	probably benign	0.27
R7734:Tenm3	UTSW	8	48646333	missense	probably damaging	1.00
R7802:Tenm3	UTSW	8	48236465	missense	probably damaging	1.00
R7812:Tenm3	UTSW	8	48276300	missense	probably benign	0.01
R7843:Tenm3	UTSW	8	48229111	nonsense	probably null
R7926:Tenm3	UTSW	8	48229111	nonsense	probably null
X0010:Tenm3	UTSW	8	48287829	missense	probably damaging	0.98
X0025:Tenm3	UTSW	8	48236477	missense	probably damaging	1.00
Z1177:Tenm3	UTSW	8	48276780	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGAAGCTGAATGCAAACTTGG -3'
(R):5'- CGCTCCATCATTATTGAAGTGC -3'

Sequencing Primer
(F):5'- GCTGAATGCAAACTTGGTTAAAGAC -3'
(R):5'- CCATCATTATTGAAGTGCTGTCCTGG -3'

Posted On

2018-03-15