Incidental Mutation 'R6270:Zswim4'
ID 507275
Institutional Source Beutler Lab
Gene Symbol Zswim4
Ensembl Gene ENSMUSG00000035671
Gene Name zinc finger SWIM-type containing 4
Synonyms E130119J17Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.132) question?
Stock # R6270 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 84210678-84237055 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 84230951 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 163 (V163M)
Ref Sequence ENSEMBL: ENSMUSP00000040078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039480]
AlphaFold Q8C7B8
Predicted Effect probably damaging
Transcript: ENSMUST00000039480
AA Change: V163M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040078
Gene: ENSMUSG00000035671
AA Change: V163M

DomainStartEndE-ValueType
low complexity region 531 545 N/A INTRINSIC
low complexity region 576 588 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
low complexity region 672 683 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
Meta Mutation Damage Score 0.3496 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik T C 18: 77,674,421 D65G probably damaging Het
Acsl6 A G 11: 54,352,107 E648G probably benign Het
Ak7 A G 12: 105,768,701 H642R probably benign Het
Akap11 T C 14: 78,518,799 E53G probably damaging Het
Ddr2 T G 1: 169,988,540 T533P probably benign Het
Dhx40 A G 11: 86,799,605 S197P possibly damaging Het
Dolpp1 C A 2: 30,392,269 probably benign Het
Eng A G 2: 32,673,643 D347G probably benign Het
Esrra C T 19: 6,914,120 probably null Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fap T C 2: 62,547,788 I159V probably damaging Het
Fn1 C T 1: 71,637,275 C599Y probably damaging Het
Fnbp4 T C 2: 90,757,463 V395A probably damaging Het
Foxn3 T C 12: 99,388,417 R163G probably damaging Het
Gphn T G 12: 78,522,950 L306R probably benign Het
Gse1 T C 8: 120,569,163 probably benign Het
Habp2 A G 19: 56,306,863 D62G possibly damaging Het
Hdac7 AGGG AGGGG 15: 97,808,495 probably null Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Kit A G 5: 75,609,509 T194A probably benign Het
Krt16 C A 11: 100,247,203 A316S possibly damaging Het
Krt7 A G 15: 101,419,558 D244G probably damaging Het
Lhfpl3 T A 5: 23,273,351 Y77* probably null Het
Lrrc18 A T 14: 33,009,121 M206L probably benign Het
Magel2 C A 7: 62,380,658 C1103* probably null Het
Mcf2l T C 8: 13,018,701 V1058A probably damaging Het
Nbas G A 12: 13,324,293 A541T probably damaging Het
Nrap C T 19: 56,320,198 M1485I probably benign Het
Nudt18 T C 14: 70,579,390 Y145H probably benign Het
Olfr175-ps1 A T 16: 58,824,419 C97S probably damaging Het
Olfr583 T C 7: 103,051,331 L11P probably benign Het
Olfr623 T C 7: 103,660,413 Y279C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb12 A T 18: 37,436,785 Q328L possibly damaging Het
Pde6c T C 19: 38,158,436 W431R probably damaging Het
Pga5 T C 19: 10,674,861 E139G probably benign Het
Pkdrej G T 15: 85,821,105 S210* probably null Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Sema3d A T 5: 12,448,107 M27L probably benign Het
Serinc5 T C 13: 92,688,662 S200P probably damaging Het
Sf3b3 T C 8: 110,841,820 D174G probably damaging Het
Sult1b1 A T 5: 87,517,554 probably null Het
Tcaf3 T C 6: 42,593,791 I342M probably benign Het
Tenm3 G A 8: 48,367,394 T136M probably damaging Het
Tet3 T C 6: 83,375,791 T1008A possibly damaging Het
Tgif1 T C 17: 70,844,866 probably null Het
Trav15-2-dv6-2 A G 14: 53,649,866 D81G probably benign Het
Trpv5 T A 6: 41,674,359 H251L possibly damaging Het
Ttc14 C A 3: 33,800,388 T37K possibly damaging Het
Vmn2r80 A T 10: 79,194,325 I662L probably benign Het
Vmn2r81 A G 10: 79,293,815 I847V probably benign Het
Zfp474 A G 18: 52,638,364 T30A probably benign Het
Other mutations in Zswim4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Zswim4 APN 8 84212140 missense probably damaging 1.00
IGL03048:Zswim4 UTSW 8 84211975 missense possibly damaging 0.95
R0217:Zswim4 UTSW 8 84212664 missense probably damaging 1.00
R0688:Zswim4 UTSW 8 84228888 missense possibly damaging 0.93
R1217:Zswim4 UTSW 8 84219972 missense possibly damaging 0.89
R1853:Zswim4 UTSW 8 84224200 missense probably damaging 1.00
R1878:Zswim4 UTSW 8 84212776 missense possibly damaging 0.55
R2205:Zswim4 UTSW 8 84225869 missense possibly damaging 0.70
R2940:Zswim4 UTSW 8 84223748 missense probably damaging 1.00
R3747:Zswim4 UTSW 8 84212047 missense possibly damaging 0.86
R3748:Zswim4 UTSW 8 84212047 missense possibly damaging 0.86
R3750:Zswim4 UTSW 8 84212047 missense possibly damaging 0.86
R4777:Zswim4 UTSW 8 84236957 missense probably benign
R4831:Zswim4 UTSW 8 84212319 missense probably damaging 1.00
R4959:Zswim4 UTSW 8 84212223 missense probably benign 0.22
R4968:Zswim4 UTSW 8 84217372 missense probably benign 0.37
R4973:Zswim4 UTSW 8 84212223 missense probably benign 0.22
R4977:Zswim4 UTSW 8 84226667 splice site probably null
R4978:Zswim4 UTSW 8 84226667 splice site probably null
R4980:Zswim4 UTSW 8 84226667 splice site probably null
R4981:Zswim4 UTSW 8 84226667 splice site probably null
R4982:Zswim4 UTSW 8 84226667 splice site probably null
R4983:Zswim4 UTSW 8 84226667 splice site probably null
R5248:Zswim4 UTSW 8 84219932 missense probably benign 0.13
R5337:Zswim4 UTSW 8 84235079 missense probably damaging 1.00
R5366:Zswim4 UTSW 8 84212790 missense probably benign 0.39
R5646:Zswim4 UTSW 8 84231110 splice site probably null
R5845:Zswim4 UTSW 8 84217242 splice site probably null
R6193:Zswim4 UTSW 8 84226145 missense probably benign
R6648:Zswim4 UTSW 8 84230914 missense probably benign 0.22
R6920:Zswim4 UTSW 8 84214085 missense probably benign 0.01
R7117:Zswim4 UTSW 8 84214052 missense probably damaging 1.00
R7155:Zswim4 UTSW 8 84219927 missense probably damaging 1.00
R7344:Zswim4 UTSW 8 84223698 nonsense probably null
R7354:Zswim4 UTSW 8 84228849 missense probably damaging 1.00
R8036:Zswim4 UTSW 8 84223289 missense probably benign 0.22
R8408:Zswim4 UTSW 8 84212385 missense possibly damaging 0.82
R8518:Zswim4 UTSW 8 84211957 missense probably damaging 1.00
R8750:Zswim4 UTSW 8 84212684 missense possibly damaging 0.82
R8830:Zswim4 UTSW 8 84223316 missense possibly damaging 0.92
R8838:Zswim4 UTSW 8 84214070 missense probably damaging 1.00
R8840:Zswim4 UTSW 8 84214070 missense probably damaging 1.00
R8842:Zswim4 UTSW 8 84214070 missense probably damaging 1.00
R9185:Zswim4 UTSW 8 84237004 start codon destroyed probably null 0.94
R9355:Zswim4 UTSW 8 84229058 missense probably damaging 1.00
R9432:Zswim4 UTSW 8 84236910 missense probably damaging 1.00
R9635:Zswim4 UTSW 8 84212725 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGAGGATCTCGTCAGCAAGAC -3'
(R):5'- CCTGAGTGGGAACATCAGAG -3'

Sequencing Primer
(F):5'- TCAGCAAGACGTTGGGC -3'
(R):5'- GCGATCCCGTCTCCTCAGTG -3'
Posted On 2018-03-15