Mutagenetix > Incidental Mutation

Incidental Mutation 'R6270:Vmn2r80'

507280

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r80

Ensembl Gene

ENSMUSG00000091888

Gene Name

vomeronasal 2, receptor 80

Synonyms

EG624765

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R6270 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79148797-79195012 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 79194325 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 662 (I662L)

Ref Sequence

ENSEMBL: ENSMUSP00000132299 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165834]

AlphaFold

E9Q1L0

Predicted Effect

probably benign
Transcript: ENSMUST00000165834
AA Change: I662L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000132299
Gene: ENSMUSG00000091888
AA Change: I662L

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ANF_receptor	79	474	1.5e-36	PFAM
Pfam:NCD3G	517	570	7.9e-22	PFAM
Pfam:7tm_3	603	838	6.2e-49	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.6%

Validation Efficiency

98% (51/52)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030462N17Rik	T	C	18: 77,674,421	D65G	probably damaging	Het
Acsl6	A	G	11: 54,352,107	E648G	probably benign	Het
Ak7	A	G	12: 105,768,701	H642R	probably benign	Het
Akap11	T	C	14: 78,518,799	E53G	probably damaging	Het
Ddr2	T	G	1: 169,988,540	T533P	probably benign	Het
Dhx40	A	G	11: 86,799,605	S197P	possibly damaging	Het
Dolpp1	C	A	2: 30,392,269		probably benign	Het
Eng	A	G	2: 32,673,643	D347G	probably benign	Het
Esrra	C	T	19: 6,914,120		probably null	Het
Fam208b	C	T	13: 3,581,891	R870H	possibly damaging	Het
Fap	T	C	2: 62,547,788	I159V	probably damaging	Het
Fn1	C	T	1: 71,637,275	C599Y	probably damaging	Het
Fnbp4	T	C	2: 90,757,463	V395A	probably damaging	Het
Foxn3	T	C	12: 99,388,417	R163G	probably damaging	Het
Gphn	T	G	12: 78,522,950	L306R	probably benign	Het
Gse1	T	C	8: 120,569,163		probably benign	Het
Habp2	A	G	19: 56,306,863	D62G	possibly damaging	Het
Hdac7	AGGG	AGGGG	15: 97,808,495		probably null	Het
Hyls1	G	A	9: 35,561,184	S312F	probably benign	Het
Kit	A	G	5: 75,609,509	T194A	probably benign	Het
Krt16	C	A	11: 100,247,203	A316S	possibly damaging	Het
Krt7	A	G	15: 101,419,558	D244G	probably damaging	Het
Lhfpl3	T	A	5: 23,273,351	Y77*	probably null	Het
Lrrc18	A	T	14: 33,009,121	M206L	probably benign	Het
Magel2	C	A	7: 62,380,658	C1103*	probably null	Het
Mcf2l	T	C	8: 13,018,701	V1058A	probably damaging	Het
Nbas	G	A	12: 13,324,293	A541T	probably damaging	Het
Nrap	C	T	19: 56,320,198	M1485I	probably benign	Het
Nudt18	T	C	14: 70,579,390	Y145H	probably benign	Het
Olfr175-ps1	A	T	16: 58,824,419	C97S	probably damaging	Het
Olfr583	T	C	7: 103,051,331	L11P	probably benign	Het
Olfr623	T	C	7: 103,660,413	Y279C	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pcdhb12	A	T	18: 37,436,785	Q328L	possibly damaging	Het
Pde6c	T	C	19: 38,158,436	W431R	probably damaging	Het
Pga5	T	C	19: 10,674,861	E139G	probably benign	Het
Pkdrej	G	T	15: 85,821,105	S210*	probably null	Het
Pnpla1	G	A	17: 28,881,368	G403E	probably benign	Het
Sema3d	A	T	5: 12,448,107	M27L	probably benign	Het
Serinc5	T	C	13: 92,688,662	S200P	probably damaging	Het
Sf3b3	T	C	8: 110,841,820	D174G	probably damaging	Het
Sult1b1	A	T	5: 87,517,554		probably null	Het
Tcaf3	T	C	6: 42,593,791	I342M	probably benign	Het
Tenm3	G	A	8: 48,367,394	T136M	probably damaging	Het
Tet3	T	C	6: 83,375,791	T1008A	possibly damaging	Het
Tgif1	T	C	17: 70,844,866		probably null	Het
Trav15-2-dv6-2	A	G	14: 53,649,866	D81G	probably benign	Het
Trpv5	T	A	6: 41,674,359	H251L	possibly damaging	Het
Ttc14	C	A	3: 33,800,388	T37K	possibly damaging	Het
Vmn2r81	A	G	10: 79,293,815	I847V	probably benign	Het
Zfp474	A	G	18: 52,638,364	T30A	probably benign	Het
Zswim4	C	T	8: 84,230,951	V163M	probably damaging	Het

Other mutations in Vmn2r80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01084:Vmn2r80	APN	10	79194599	missense	probably damaging	1.00
IGL01325:Vmn2r80	APN	10	79194247	missense	possibly damaging	0.62
IGL01611:Vmn2r80	APN	10	79171654	missense	probably damaging	1.00
IGL01799:Vmn2r80	APN	10	79171551	missense	possibly damaging	0.95
IGL01877:Vmn2r80	APN	10	79171500	splice site	probably null
IGL02673:Vmn2r80	APN	10	79169484	missense	probably benign	0.02
IGL02756:Vmn2r80	APN	10	79194311	missense	probably damaging	1.00
IGL02820:Vmn2r80	APN	10	79171605	missense	probably benign	0.04
IGL03382:Vmn2r80	APN	10	79169528	missense	probably damaging	1.00
R0071:Vmn2r80	UTSW	10	79171732	missense	possibly damaging	0.83
R0071:Vmn2r80	UTSW	10	79171732	missense	possibly damaging	0.83
R0129:Vmn2r80	UTSW	10	79169496	missense	probably damaging	1.00
R0325:Vmn2r80	UTSW	10	79148939	missense	possibly damaging	0.89
R0567:Vmn2r80	UTSW	10	79194831	missense	possibly damaging	0.89
R1510:Vmn2r80	UTSW	10	79169719	missense	possibly damaging	0.69
R1519:Vmn2r80	UTSW	10	79194219	missense	probably damaging	1.00
R1520:Vmn2r80	UTSW	10	79194760	missense	probably damaging	1.00
R1627:Vmn2r80	UTSW	10	79194415	missense	probably damaging	1.00
R1709:Vmn2r80	UTSW	10	79194389	missense	probably benign	0.04
R2116:Vmn2r80	UTSW	10	79194724	missense	probably benign	0.09
R2237:Vmn2r80	UTSW	10	79168270	missense	probably damaging	1.00
R2308:Vmn2r80	UTSW	10	79171621	missense	probably damaging	1.00
R2893:Vmn2r80	UTSW	10	79148865	missense	possibly damaging	0.63
R3408:Vmn2r80	UTSW	10	79168393	missense	possibly damaging	0.95
R4502:Vmn2r80	UTSW	10	79148930	missense	probably benign	0.00
R4685:Vmn2r80	UTSW	10	79194328	missense	possibly damaging	0.95
R4851:Vmn2r80	UTSW	10	79194322	missense	possibly damaging	0.68
R4947:Vmn2r80	UTSW	10	79194698	missense	probably damaging	1.00
R5112:Vmn2r80	UTSW	10	79194458	missense	possibly damaging	0.61
R5217:Vmn2r80	UTSW	10	79169146	missense	possibly damaging	0.62
R5226:Vmn2r80	UTSW	10	79194040	missense	probably benign	0.36
R5512:Vmn2r80	UTSW	10	79168232	missense	probably benign	0.00
R5618:Vmn2r80	UTSW	10	79148921	missense	probably benign
R5959:Vmn2r80	UTSW	10	79169479	missense	probably benign	0.00
R6104:Vmn2r80	UTSW	10	79149020	missense	probably benign	0.00
R6110:Vmn2r80	UTSW	10	79182003	missense	probably damaging	1.00
R6508:Vmn2r80	UTSW	10	79194456	missense	probably benign	0.03
R6843:Vmn2r80	UTSW	10	79169668	missense	probably benign	0.08
R6894:Vmn2r80	UTSW	10	79169604	missense	probably benign	0.06
R7048:Vmn2r80	UTSW	10	79194319	missense	probably damaging	1.00
R7149:Vmn2r80	UTSW	10	79194820	missense	probably benign	0.00
R7262:Vmn2r80	UTSW	10	79169745	missense	probably damaging	0.98
R7559:Vmn2r80	UTSW	10	79194625	missense	probably benign	0.00
R7622:Vmn2r80	UTSW	10	79194263	missense	probably damaging	1.00
R8003:Vmn2r80	UTSW	10	79148877	missense	probably benign	0.16
R8207:Vmn2r80	UTSW	10	79194316	nonsense	probably null
R8330:Vmn2r80	UTSW	10	79171716	missense	probably damaging	1.00
R8337:Vmn2r80	UTSW	10	79148873	missense	probably benign	0.00
R8354:Vmn2r80	UTSW	10	79148876	missense	probably benign
R8688:Vmn2r80	UTSW	10	79168235	missense	probably damaging	1.00
R8903:Vmn2r80	UTSW	10	79182094	missense	probably damaging	1.00
R9088:Vmn2r80	UTSW	10	79169544	missense	probably benign	0.05
R9125:Vmn2r80	UTSW	10	79148926	missense	probably benign	0.12
R9147:Vmn2r80	UTSW	10	79194853	missense	probably damaging	0.98
R9148:Vmn2r80	UTSW	10	79194853	missense	probably damaging	0.98
R9187:Vmn2r80	UTSW	10	79194604	missense	probably benign	0.20
R9218:Vmn2r80	UTSW	10	79194436	missense	possibly damaging	0.61
R9553:Vmn2r80	UTSW	10	79148909	missense	probably benign
R9612:Vmn2r80	UTSW	10	79194878	missense	probably damaging	1.00
R9677:Vmn2r80	UTSW	10	79148838	missense	probably benign	0.15
R9769:Vmn2r80	UTSW	10	79169609	missense	probably damaging	1.00
Z1176:Vmn2r80	UTSW	10	79169477	missense	not run
Z1176:Vmn2r80	UTSW	10	79194398	missense	possibly damaging	0.65
Z1176:Vmn2r80	UTSW	10	79194607	missense	probably damaging	1.00
Z1176:Vmn2r80	UTSW	10	79194771	missense	probably damaging	1.00
Z1177:Vmn2r80	UTSW	10	79169477	missense	not run

Predicted Primers

PCR Primer
(F):5'- AGGGAATCACACTTCTTTCCATTGG -3'
(R):5'- GGAGATGTTCCCAGCCATATACC -3'

Sequencing Primer
(F):5'- TTGGATTCTCAACACTCACAGC -3'
(R):5'- GATGTTCCCAGCCATATACCAGAGAG -3'

Posted On

2018-03-15