Incidental Mutation 'R6270:Trav15-2-dv6-2'
ID507293
Institutional Source Beutler Lab
Gene Symbol Trav15-2-dv6-2
Ensembl Gene ENSMUSG00000076848
Gene NameT cell receptor alpha variable 15-2-DV6-2
SynonymsTrav15-2/dv6-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6270 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location53649387-53649993 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53649866 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 81 (D81G)
Ref Sequence ENSEMBL: ENSMUSP00000100437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103660]
Predicted Effect probably benign
Transcript: ENSMUST00000103660
AA Change: D81G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000100437
Gene: ENSMUSG00000076848
AA Change: D81G

DomainStartEndE-ValueType
IGv 44 120 4.09e-9 SMART
Meta Mutation Damage Score 0.1216 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik T C 18: 77,674,421 D65G probably damaging Het
Acsl6 A G 11: 54,352,107 E648G probably benign Het
Ak7 A G 12: 105,768,701 H642R probably benign Het
Akap11 T C 14: 78,518,799 E53G probably damaging Het
Ddr2 T G 1: 169,988,540 T533P probably benign Het
Dhx40 A G 11: 86,799,605 S197P possibly damaging Het
Dolpp1 C A 2: 30,392,269 probably benign Het
Eng A G 2: 32,673,643 D347G probably benign Het
Esrra C T 19: 6,914,120 probably null Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fap T C 2: 62,547,788 I159V probably damaging Het
Fn1 C T 1: 71,637,275 C599Y probably damaging Het
Fnbp4 T C 2: 90,757,463 V395A probably damaging Het
Foxn3 T C 12: 99,388,417 R163G probably damaging Het
Gphn T G 12: 78,522,950 L306R probably benign Het
Gse1 T C 8: 120,569,163 probably benign Het
Habp2 A G 19: 56,306,863 D62G possibly damaging Het
Hdac7 AGGG AGGGG 15: 97,808,495 probably null Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Kit A G 5: 75,609,509 T194A probably benign Het
Krt16 C A 11: 100,247,203 A316S possibly damaging Het
Krt7 A G 15: 101,419,558 D244G probably damaging Het
Lhfpl3 T A 5: 23,273,351 Y77* probably null Het
Lrrc18 A T 14: 33,009,121 M206L probably benign Het
Magel2 C A 7: 62,380,658 C1103* probably null Het
Mcf2l T C 8: 13,018,701 V1058A probably damaging Het
Nbas G A 12: 13,324,293 A541T probably damaging Het
Nrap C T 19: 56,320,198 M1485I probably benign Het
Nudt18 T C 14: 70,579,390 Y145H probably benign Het
Olfr175-ps1 A T 16: 58,824,419 C97S probably damaging Het
Olfr583 T C 7: 103,051,331 L11P probably benign Het
Olfr623 T C 7: 103,660,413 Y279C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb12 A T 18: 37,436,785 Q328L possibly damaging Het
Pde6c T C 19: 38,158,436 W431R probably damaging Het
Pga5 T C 19: 10,674,861 E139G probably benign Het
Pkdrej G T 15: 85,821,105 S210* probably null Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Sema3d A T 5: 12,448,107 M27L probably benign Het
Serinc5 T C 13: 92,688,662 S200P probably damaging Het
Sf3b3 T C 8: 110,841,820 D174G probably damaging Het
Sult1b1 A T 5: 87,517,554 probably null Het
Tcaf3 T C 6: 42,593,791 I342M probably benign Het
Tenm3 G A 8: 48,367,394 T136M probably damaging Het
Tet3 T C 6: 83,375,791 T1008A possibly damaging Het
Tgif1 T C 17: 70,844,866 probably null Het
Trpv5 T A 6: 41,674,359 H251L possibly damaging Het
Ttc14 C A 3: 33,800,388 T37K possibly damaging Het
Vmn2r80 A T 10: 79,194,325 I662L probably benign Het
Vmn2r81 A G 10: 79,293,815 I847V probably benign Het
Zfp474 A G 18: 52,638,364 T30A probably benign Het
Zswim4 C T 8: 84,230,951 V163M probably damaging Het
Other mutations in Trav15-2-dv6-2
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Trav15-2-dv6-2 UTSW 14 53649750 small insertion probably benign
FR4548:Trav15-2-dv6-2 UTSW 14 53649757 small insertion probably benign
FR4737:Trav15-2-dv6-2 UTSW 14 53649756 small insertion probably benign
FR4737:Trav15-2-dv6-2 UTSW 14 53649757 small insertion probably benign
FR4976:Trav15-2-dv6-2 UTSW 14 53649754 nonsense probably null
FR4976:Trav15-2-dv6-2 UTSW 14 53649757 small insertion probably benign
R5966:Trav15-2-dv6-2 UTSW 14 53649976 missense probably damaging 1.00
R6113:Trav15-2-dv6-2 UTSW 14 53649725 missense probably benign 0.00
R7298:Trav15-2-dv6-2 UTSW 14 53649785 missense probably benign 0.41
R7528:Trav15-2-dv6-2 UTSW 14 53649851 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AATGTGGCCCAGAGAGTGAC -3'
(R):5'- ATCCACAGTTGGGGTCTCCTTG -3'

Sequencing Primer
(F):5'- TGACTCAGGTCCAGTCAACAGG -3'
(R):5'- GCTTAAGGAGCCCCAGTTTTTG -3'
Posted On2018-03-15