Incidental Mutation 'R6271:Ces2c'
ID507335
Institutional Source Beutler Lab
Gene Symbol Ces2c
Ensembl Gene ENSMUSG00000061825
Gene Namecarboxylesterase 2C
SynonymsCes2
MMRRC Submission 044379-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6271 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location104847068-104854483 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104852116 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 342 (G342D)
Ref Sequence ENSEMBL: ENSMUSP00000058567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055052]
Predicted Effect probably damaging
Transcript: ENSMUST00000055052
AA Change: G342D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058567
Gene: ENSMUSG00000061825
AA Change: G342D

DomainStartEndE-ValueType
Pfam:COesterase 11 540 1.5e-173 PFAM
Pfam:Abhydrolase_3 145 278 6.5e-8 PFAM
Pfam:Peptidase_S9 160 293 4e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162970
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. The protein encoded by this gene is the major intestinal enzyme and functions in intestine drug clearance. The transcription of this gene is regulated by several factors including HNF-4alpha (hepatocyte nuclear factor-4alpha), Sp1 (specificity protein 1), Sp3 and USF1 (upstream stimulatory factor 1). The expression and activity of this gene is age-related but independent of growth hormone level. This gene is clustered with several family members including a few of pseudogenes and Ces5 on chromosome 8.[provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 G T 4: 133,064,724 C1092F possibly damaging Het
Aplf T C 6: 87,646,248 E304G possibly damaging Het
Atp12a A G 14: 56,378,422 D547G probably benign Het
B3gat2 T C 1: 23,815,261 L212P probably damaging Het
Babam2 G T 5: 32,001,362 A219S probably damaging Het
Ccdc18 A C 5: 108,174,887 S618R possibly damaging Het
Cfap57 A C 4: 118,595,759 D582E probably benign Het
Cisd2 T C 3: 135,408,866 N115D possibly damaging Het
Cyp17a1 A G 19: 46,672,720 F42L probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fam234a T C 17: 26,218,237 D156G probably benign Het
Fer1l6 T A 15: 58,641,918 I1554K probably benign Het
Fv1 A G 4: 147,870,017 T347A possibly damaging Het
Gm5134 T A 10: 75,995,809 C361S probably benign Het
Gm5415 T A 1: 32,545,491 D446V probably damaging Het
Grin3a T C 4: 49,792,516 I406V probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ifna13 A C 4: 88,643,845 L181V possibly damaging Het
Irx4 A G 13: 73,266,594 probably null Het
Kcna3 T A 3: 107,037,606 M395K probably damaging Het
Kcnma1 A T 14: 23,509,889 V347D probably damaging Het
Kng2 A T 16: 23,003,948 V218E probably benign Het
Krt36 G A 11: 100,104,472 Q167* probably null Het
Lama2 T C 10: 27,023,329 D2457G possibly damaging Het
Ldah G A 12: 8,268,599 probably null Het
Lhfpl3 G T 5: 22,746,244 A18S probably benign Het
Lrrk1 A G 7: 66,307,103 probably null Het
Ltv1 T C 10: 13,179,701 Y352C probably damaging Het
Lyst G T 13: 13,658,754 M1720I probably benign Het
Mkx A T 18: 6,937,059 probably null Het
Myo18a A G 11: 77,820,809 H626R probably damaging Het
Nop9 A C 14: 55,753,741 Q618H probably damaging Het
Olfr1255 T C 2: 89,816,562 S73P probably damaging Het
Olfr25 T C 9: 38,330,282 S232P probably benign Het
Olfr358 T C 2: 37,005,542 Q24R probably damaging Het
Olfr850 A G 9: 19,478,041 S67P probably damaging Het
Otog C A 7: 46,252,040 Q388K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Oxct2b T G 4: 123,117,715 V476G probably damaging Het
Parp10 T C 15: 76,242,002 T329A probably benign Het
Pcdhga5 T C 18: 37,696,682 S728P probably benign Het
Piezo1 G T 8: 122,494,932 H574Q probably damaging Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Pqlc3 T C 12: 16,997,703 D76G probably damaging Het
Preb C A 5: 30,958,051 V255F probably damaging Het
Prmt9 A G 8: 77,577,463 N725S probably damaging Het
Ric1 A T 19: 29,567,365 probably null Het
Serinc3 G C 2: 163,630,976 L245V probably benign Het
Sgce T C 6: 4,730,015 K70E possibly damaging Het
Simc1 T G 13: 54,539,724 V102G probably damaging Het
Smyd2 A G 1: 189,883,852 Y362H probably damaging Het
Sptbn1 G T 11: 30,100,660 H2310N probably benign Het
Syne1 T C 10: 5,234,652 Y4077C probably damaging Het
Syne2 C A 12: 75,890,381 A251E probably damaging Het
Taok1 A T 11: 77,573,783 L159Q probably damaging Het
Timeless T C 10: 128,250,724 L1043P probably damaging Het
Tmprss3 T C 17: 31,186,562 E352G probably damaging Het
Trav6-4 A T 14: 53,454,582 T46S probably benign Het
Ubiad1 A T 4: 148,436,626 Y180* probably null Het
Usp47 A G 7: 112,087,056 E627G probably damaging Het
Vmn2r124 A G 17: 18,062,883 T280A probably benign Het
Other mutations in Ces2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00653:Ces2c APN 8 104849736 missense possibly damaging 0.92
IGL01989:Ces2c APN 8 104849743 missense probably damaging 1.00
IGL02523:Ces2c APN 8 104848114 missense probably damaging 0.99
IGL03213:Ces2c APN 8 104848040 missense probably benign 0.19
R0050:Ces2c UTSW 8 104848199 missense probably benign 0.25
R0050:Ces2c UTSW 8 104848199 missense probably benign 0.25
R0288:Ces2c UTSW 8 104849744 missense probably benign 0.04
R0506:Ces2c UTSW 8 104848024 missense probably damaging 1.00
R4727:Ces2c UTSW 8 104848040 missense probably benign 0.19
R5995:Ces2c UTSW 8 104850901 missense possibly damaging 0.81
R6283:Ces2c UTSW 8 104849699 missense probably benign
R6533:Ces2c UTSW 8 104852093 missense possibly damaging 0.75
R7453:Ces2c UTSW 8 104849670 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGGAGGTTACTCAGTAGACATCAG -3'
(R):5'- AGAACAGCCTGCAGGTTCTC -3'

Sequencing Primer
(F):5'- TCAAGATGATCCCTGCTG -3'
(R):5'- TTATCATCTGAGCAGAGCCCATG -3'
Posted On2018-03-15