Mutagenetix > Incidental Mutations

Incidental Mutation 'R6271:Ric1'

507370

Institutional Source

Beutler Lab

Gene Symbol

Ric1

Ensembl Gene

ENSMUSG00000038658

Gene Name

RAB6A GEF complex partner 1

Synonyms

C030046E11Rik, C130057E09Rik

MMRRC Submission

044379-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.411) question?

Stock #

R6271 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

29522282-29606829 bp(+) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

A to T at 29567365 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043610] [ENSMUST00000162184]

Predicted Effect

probably null
Transcript: ENSMUST00000043610

SMART Domains

Protein: ENSMUSP00000043437
Gene: ENSMUSG00000038658

Domain	Start	End	E-Value	Type
Blast:WD40	242	278	5e-7	BLAST
SCOP:d1gxra_	254	379	2e-4	SMART
Blast:WD40	285	334	3e-6	BLAST
Blast:WD40	482	520	5e-6	BLAST
low complexity region	642	653	N/A	INTRINSIC
Pfam:RIC1	732	991	1.9e-86	PFAM
low complexity region	1120	1132	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160221

Predicted Effect

probably benign
Transcript: ENSMUST00000162184

Predicted Effect

probably null
Transcript: ENSMUST00000162492

SMART Domains

Protein: ENSMUSP00000124727
Gene: ENSMUSG00000038658

Domain	Start	End	E-Value	Type
Blast:WD40	171	207	4e-7	BLAST
SCOP:d1gxra_	183	308	2e-4	SMART
Blast:WD40	214	263	2e-6	BLAST
low complexity region	534	545	N/A	INTRINSIC
Pfam:RIC1	624	883	1.6e-86	PFAM
low complexity region	1012	1024	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahdc1	G	T	4: 133,064,724	C1092F	possibly damaging	Het
Aplf	T	C	6: 87,646,248	E304G	possibly damaging	Het
Atp12a	A	G	14: 56,378,422	D547G	probably benign	Het
B3gat2	T	C	1: 23,815,261	L212P	probably damaging	Het
Babam2	G	T	5: 32,001,362	A219S	probably damaging	Het
Ccdc18	A	C	5: 108,174,887	S618R	possibly damaging	Het
Ces2c	G	A	8: 104,852,116	G342D	probably damaging	Het
Cfap57	A	C	4: 118,595,759	D582E	probably benign	Het
Cisd2	T	C	3: 135,408,866	N115D	possibly damaging	Het
Cyp17a1	A	G	19: 46,672,720	F42L	probably benign	Het
Fam208b	C	T	13: 3,581,891	R870H	possibly damaging	Het
Fam234a	T	C	17: 26,218,237	D156G	probably benign	Het
Fer1l6	T	A	15: 58,641,918	I1554K	probably benign	Het
Fv1	A	G	4: 147,870,017	T347A	possibly damaging	Het
Gm5134	T	A	10: 75,995,809	C361S	probably benign	Het
Gm5415	T	A	1: 32,545,491	D446V	probably damaging	Het
Grin3a	T	C	4: 49,792,516	I406V	probably benign	Het
Hyls1	G	A	9: 35,561,184	S312F	probably benign	Het
Ifna13	A	C	4: 88,643,845	L181V	possibly damaging	Het
Irx4	A	G	13: 73,266,594		probably null	Het
Kcna3	T	A	3: 107,037,606	M395K	probably damaging	Het
Kcnma1	A	T	14: 23,509,889	V347D	probably damaging	Het
Kng2	A	T	16: 23,003,948	V218E	probably benign	Het
Krt36	G	A	11: 100,104,472	Q167*	probably null	Het
Lama2	T	C	10: 27,023,329	D2457G	possibly damaging	Het
Ldah	G	A	12: 8,268,599		probably null	Het
Lhfpl3	G	T	5: 22,746,244	A18S	probably benign	Het
Lrrk1	A	G	7: 66,307,103		probably null	Het
Ltv1	T	C	10: 13,179,701	Y352C	probably damaging	Het
Lyst	G	T	13: 13,658,754	M1720I	probably benign	Het
Mkx	A	T	18: 6,937,059		probably null	Het
Myo18a	A	G	11: 77,820,809	H626R	probably damaging	Het
Nop9	A	C	14: 55,753,741	Q618H	probably damaging	Het
Olfr1255	T	C	2: 89,816,562	S73P	probably damaging	Het
Olfr25	T	C	9: 38,330,282	S232P	probably benign	Het
Olfr358	T	C	2: 37,005,542	Q24R	probably damaging	Het
Olfr850	A	G	9: 19,478,041	S67P	probably damaging	Het
Otog	C	A	7: 46,252,040	Q388K	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Oxct2b	T	G	4: 123,117,715	V476G	probably damaging	Het
Parp10	T	C	15: 76,242,002	T329A	probably benign	Het
Pcdhga5	T	C	18: 37,696,682	S728P	probably benign	Het
Piezo1	G	T	8: 122,494,932	H574Q	probably damaging	Het
Pnpla1	G	A	17: 28,881,368	G403E	probably benign	Het
Pqlc3	T	C	12: 16,997,703	D76G	probably damaging	Het
Preb	C	A	5: 30,958,051	V255F	probably damaging	Het
Prmt9	A	G	8: 77,577,463	N725S	probably damaging	Het
Serinc3	G	C	2: 163,630,976	L245V	probably benign	Het
Sgce	T	C	6: 4,730,015	K70E	possibly damaging	Het
Simc1	T	G	13: 54,539,724	V102G	probably damaging	Het
Smyd2	A	G	1: 189,883,852	Y362H	probably damaging	Het
Sptbn1	G	T	11: 30,100,660	H2310N	probably benign	Het
Syne1	T	C	10: 5,234,652	Y4077C	probably damaging	Het
Syne2	C	A	12: 75,890,381	A251E	probably damaging	Het
Taok1	A	T	11: 77,573,783	L159Q	probably damaging	Het
Timeless	T	C	10: 128,250,724	L1043P	probably damaging	Het
Tmprss3	T	C	17: 31,186,562	E352G	probably damaging	Het
Trav6-4	A	T	14: 53,454,582	T46S	probably benign	Het
Ubiad1	A	T	4: 148,436,626	Y180*	probably null	Het
Usp47	A	G	7: 112,087,056	E627G	probably damaging	Het
Vmn2r124	A	G	17: 18,062,883	T280A	probably benign	Het

Other mutations in Ric1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00574:Ric1	APN	19	29595362	missense	probably damaging	1.00
IGL00902:Ric1	APN	19	29567231	missense	probably benign	0.05
IGL01405:Ric1	APN	19	29567370	splice site	probably benign
IGL01629:Ric1	APN	19	29603981	missense	probably benign	0.02
IGL01688:Ric1	APN	19	29577614	missense	probably benign	0.00
IGL01966:Ric1	APN	19	29595563	missense	probably benign	0.33
IGL02123:Ric1	APN	19	29594800	missense	probably benign
IGL02590:Ric1	APN	19	29567481	splice site	probably benign
IGL02655:Ric1	APN	19	29595451	missense	probably damaging	1.00
IGL02699:Ric1	APN	19	29522557	missense	possibly damaging	0.51
IGL02718:Ric1	APN	19	29533240	missense	probably damaging	1.00
IGL03026:Ric1	APN	19	29599833	missense	probably benign	0.02
IGL03142:Ric1	APN	19	29600980	missense	possibly damaging	0.89
R0109:Ric1	UTSW	19	29586677	synonymous	silent
R0336:Ric1	UTSW	19	29587793	missense	probably damaging	0.96
R0362:Ric1	UTSW	19	29601011	critical splice donor site	probably null
R0676:Ric1	UTSW	19	29577647	missense	probably benign
R0734:Ric1	UTSW	19	29594818	missense	possibly damaging	0.66
R1004:Ric1	UTSW	19	29602357	missense	probably benign	0.00
R1148:Ric1	UTSW	19	29579849	missense	probably benign
R1148:Ric1	UTSW	19	29579849	missense	probably benign
R1216:Ric1	UTSW	19	29577735	missense	probably benign	0.00
R1493:Ric1	UTSW	19	29579849	missense	probably benign
R1848:Ric1	UTSW	19	29600813	splice site	probably null
R1872:Ric1	UTSW	19	29602668	missense	probably benign	0.32
R1942:Ric1	UTSW	19	29601016	splice site	probably benign
R2143:Ric1	UTSW	19	29533252	missense	probably damaging	1.00
R2143:Ric1	UTSW	19	29533253	missense	probably damaging	0.96
R2679:Ric1	UTSW	19	29604030	missense	probably benign
R2878:Ric1	UTSW	19	29602330	missense	possibly damaging	0.77
R2970:Ric1	UTSW	19	29577718	missense	probably benign	0.15
R3420:Ric1	UTSW	19	29567590	missense	probably damaging	0.96
R3421:Ric1	UTSW	19	29567590	missense	probably damaging	0.96
R3940:Ric1	UTSW	19	29570762	missense	probably damaging	1.00
R4004:Ric1	UTSW	19	29579801	missense	probably benign	0.44
R4225:Ric1	UTSW	19	29602731	missense	possibly damaging	0.89
R4280:Ric1	UTSW	19	29586550	missense	probably damaging	1.00
R4283:Ric1	UTSW	19	29586550	missense	probably damaging	1.00
R4516:Ric1	UTSW	19	29570765	missense	probably benign	0.17
R4702:Ric1	UTSW	19	29598017	missense	possibly damaging	0.85
R4824:Ric1	UTSW	19	29585842	missense	probably damaging	1.00
R4835:Ric1	UTSW	19	29595536	missense	possibly damaging	0.80
R5860:Ric1	UTSW	19	29599845	missense	possibly damaging	0.91
R5883:Ric1	UTSW	19	29595989	missense	probably damaging	1.00
R5965:Ric1	UTSW	19	29570771	missense	probably damaging	0.99
R6141:Ric1	UTSW	19	29595442	missense	probably damaging	1.00
R6236:Ric1	UTSW	19	29595426	missense	possibly damaging	0.91
R6345:Ric1	UTSW	19	29604085	missense	probably benign	0.09
R6371:Ric1	UTSW	19	29562026	missense	probably benign	0.35
R6547:Ric1	UTSW	19	29594826	missense	probably damaging	1.00
R6924:Ric1	UTSW	19	29569388	missense	probably damaging	0.98
R6969:Ric1	UTSW	19	29585782	missense	probably damaging	1.00
R6970:Ric1	UTSW	19	29587772	missense	probably damaging	1.00
R6993:Ric1	UTSW	19	29586613	missense	probably damaging	1.00
R7296:Ric1	UTSW	19	29584578	critical splice donor site	probably null
R7434:Ric1	UTSW	19	29574780	missense	probably damaging	1.00
R7619:Ric1	UTSW	19	29579775	missense	probably benign	0.32
R7850:Ric1	UTSW	19	29594893	missense	probably benign
R7941:Ric1	UTSW	19	29533259	missense	probably damaging	1.00
R8115:Ric1	UTSW	19	29586573	missense	probably damaging	1.00
R8117:Ric1	UTSW	19	29574791	missense	probably benign	0.08
R8477:Ric1	UTSW	19	29597783	missense	probably damaging	1.00
X0064:Ric1	UTSW	19	29587802	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTGAGTTGCTTGCTTCCG -3'
(R):5'- TGCCGTAAATCTACTGGATACTG -3'

Sequencing Primer
(F):5'- CCGTCCAGTTTGCAGTCTGTG -3'
(R):5'- CCATCAAGTGTGGCACAGTATTC -3'

Posted On

2018-03-15