Mutagenetix > Incidental Mutations

Incidental Mutation 'R6272:Ubqln3'

507396

Institutional Source

Beutler Lab

Gene Symbol

Ubqln3

Ensembl Gene

ENSMUSG00000051618

Gene Name

ubiquilin 3

Synonyms

4933400K24Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.178) question?

Stock #

R6272 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104140623-104143279 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 104142178 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 235 (R235H)

Ref Sequence

ENSEMBL: ENSMUSP00000055229 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]

Predicted Effect

probably damaging
Transcript: ENSMUST00000057254
AA Change: R235H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: R235H

Domain	Start	End	E-Value	Type
UBQ	22	92	1.56e-15	SMART
low complexity region	103	115	N/A	INTRINSIC
low complexity region	120	151	N/A	INTRINSIC
STI1	194	233	4.25e-7	SMART
low complexity region	280	291	N/A	INTRINSIC
low complexity region	313	328	N/A	INTRINSIC
low complexity region	505	515	N/A	INTRINSIC
UBA	619	657	4.22e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000138055

SMART Domains

Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

Domain	Start	End	E-Value	Type
transmembrane domain	29	51	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.3%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgra3	A	T	5: 50,009,449	M187K	possibly damaging	Het
Adgrg3	A	G	8: 95,036,261	I189V	noncoding transcript	Het
Ampd1	A	G	3: 103,085,383	K147R	possibly damaging	Het
Apbb2	T	C	5: 66,311,072	T561A	probably damaging	Het
Arfgef3	A	T	10: 18,646,963	D438E	probably benign	Het
Atxn1	T	A	13: 45,567,762	Q219L	possibly damaging	Het
AW551984	A	T	9: 39,598,037	D269E	probably benign	Het
Cryab	A	G	9: 50,754,525	K72R	possibly damaging	Het
Dbn1	G	A	13: 55,475,104	A522V	probably benign	Het
Dip2a	A	T	10: 76,286,407	*158R	probably null	Het
Edrf1	C	T	7: 133,637,808		probably benign	Het
Ern2	A	T	7: 122,176,646	D408E	probably benign	Het
F830016B08Rik	T	C	18: 60,300,078	S78P	probably damaging	Het
Fah	C	A	7: 84,595,545	G137C	probably damaging	Het
Fam208b	C	T	13: 3,581,891	R870H	possibly damaging	Het
Foxd3	A	G	4: 99,656,740	D39G	probably damaging	Het
Gm3854	C	T	7: 6,353,845	P219L	probably damaging	Het
Gprin3	G	A	6: 59,353,331	Q664*	probably null	Het
H2-Ob	T	C	17: 34,242,644	I119T	probably benign	Het
Hist1h3e	A	T	13: 23,562,226	V47E	probably damaging	Het
Hmgcll1	G	A	9: 76,130,345	G174R	probably damaging	Het
Kbtbd11	T	A	8: 15,029,118	C572*	probably null	Het
Kynu	A	T	2: 43,634,989	N315Y	probably benign	Het
Map1lc3b	G	A	8: 121,596,690	E100K	probably benign	Het
Matn2	T	A	15: 34,355,607	Q33L	possibly damaging	Het
Mettl8	T	C	2: 70,976,075		probably null	Het
Neto1	A	T	18: 86,494,815	N312Y	probably damaging	Het
Nhsl1	A	G	10: 18,524,505	D493G	probably benign	Het
Nup210l	A	G	3: 90,170,024	E889G	possibly damaging	Het
Olfr1153	G	A	2: 87,896,657	V153I	probably benign	Het
Olfr1383	C	A	11: 49,524,126	S134R	possibly damaging	Het
Olfr1402	A	G	3: 97,410,891	F97L	probably benign	Het
Olfr209	A	C	16: 59,361,585	M211R	possibly damaging	Het
Olfr296-ps1	A	G	7: 86,561,873	Y47C	unknown	Het
Olfr420	C	T	1: 174,159,175	T134I	probably benign	Het
Olfr967	A	T	9: 39,750,520	M45L	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Phc2	A	G	4: 128,709,647	Y190C	probably damaging	Het
Platr25	T	C	13: 62,672,997	T347A	possibly damaging	Het
Plec	T	C	15: 76,174,853	E3655G	probably damaging	Het
Plekhg3	A	T	12: 76,576,845	Q954L	probably benign	Het
Pnpla1	G	A	17: 28,881,368	G403E	probably benign	Het
Prdm4	G	A	10: 85,907,830	T187I	possibly damaging	Het
Prg4	T	C	1: 150,454,766		probably benign	Het
Prpf18	G	A	2: 4,633,447	R312W	probably damaging	Het
Rnf213	T	A	11: 119,414,548	V535D	probably damaging	Het
Rtcb	A	T	10: 85,955,774	N39K	probably damaging	Het
Slc4a3	G	A	1: 75,554,697		probably null	Het
Szt2	A	C	4: 118,374,290		probably benign	Het
Tfap2e	A	T	4: 126,721,864	V259D	probably damaging	Het
Trav19	A	G	14: 53,845,798	D110G	probably damaging	Het
Ttc17	A	C	2: 94,358,755	C749W	probably damaging	Het
Ttc8	A	G	12: 98,982,494	K490E	possibly damaging	Het
Ube4b	A	G	4: 149,387,133	S99P	probably damaging	Het
Vmn2r61	A	T	7: 42,299,818	D554V	probably damaging	Het
Vmn2r70	A	T	7: 85,558,986	V761E	probably damaging	Het
Vmn2r97	T	C	17: 18,947,599	I705T	possibly damaging	Het
Wwox	G	A	8: 114,488,952	C155Y	probably damaging	Het
Zfp451	T	C	1: 33,803,244		probably benign	Het

Other mutations in Ubqln3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00656:Ubqln3	APN	7	104141777	missense	probably benign	0.00
IGL00766:Ubqln3	APN	7	104142824	missense	probably benign	0.00
IGL01451:Ubqln3	APN	7	104142196	missense	possibly damaging	0.71
IGL01673:Ubqln3	APN	7	104142398	missense	probably benign	0.12
IGL01705:Ubqln3	APN	7	104142677	missense	probably damaging	1.00
IGL01988:Ubqln3	APN	7	104142882	utr 5 prime	probably benign
IGL02008:Ubqln3	APN	7	104142316	missense	probably damaging	1.00
IGL02072:Ubqln3	APN	7	104141299	missense	possibly damaging	0.69
IGL02546:Ubqln3	APN	7	104142518	missense	probably benign	0.02
IGL02657:Ubqln3	APN	7	104141963	missense	probably damaging	0.97
IGL02682:Ubqln3	APN	7	104142065	missense	probably benign	0.19
IGL02709:Ubqln3	APN	7	104141336	missense	probably benign	0.12
IGL03357:Ubqln3	APN	7	104142556	missense	probably benign
PIT4544001:Ubqln3	UTSW	7	104141343	missense	probably damaging	0.97
R0180:Ubqln3	UTSW	7	104141840	missense	probably damaging	1.00
R0845:Ubqln3	UTSW	7	104142068	missense	probably damaging	0.98
R1019:Ubqln3	UTSW	7	104141386	missense	probably benign	0.00
R1280:Ubqln3	UTSW	7	104142076	missense	possibly damaging	0.85
R1448:Ubqln3	UTSW	7	104142790	missense	probably damaging	1.00
R1550:Ubqln3	UTSW	7	104141546	missense	probably damaging	0.98
R1617:Ubqln3	UTSW	7	104142860	missense	possibly damaging	0.95
R1650:Ubqln3	UTSW	7	104141021	missense	possibly damaging	0.84
R2060:Ubqln3	UTSW	7	104142151	missense	probably damaging	1.00
R2246:Ubqln3	UTSW	7	104142311	missense	probably damaging	1.00
R2263:Ubqln3	UTSW	7	104141635	nonsense	probably null
R2366:Ubqln3	UTSW	7	104141049	missense	probably damaging	0.99
R4232:Ubqln3	UTSW	7	104141803	missense	probably benign	0.00
R4447:Ubqln3	UTSW	7	104142814	missense	probably benign	0.31
R4509:Ubqln3	UTSW	7	104141444	missense	probably damaging	0.97
R4604:Ubqln3	UTSW	7	104142491	missense	probably benign	0.00
R5416:Ubqln3	UTSW	7	104141672	missense	probably benign	0.34
R5617:Ubqln3	UTSW	7	104142433	missense	probably damaging	0.99
R5648:Ubqln3	UTSW	7	104140910	missense	probably damaging	0.99
R5722:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5723:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5724:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5819:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5820:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5966:Ubqln3	UTSW	7	104141699	missense	probably benign	0.03
R6260:Ubqln3	UTSW	7	104142317	nonsense	probably null
R6542:Ubqln3	UTSW	7	104141617	missense	probably benign	0.00
R6936:Ubqln3	UTSW	7	104142310	missense	probably damaging	1.00
R7023:Ubqln3	UTSW	7	104141423	missense	probably damaging	1.00
R7025:Ubqln3	UTSW	7	104141275	missense	probably benign	0.01
R7079:Ubqln3	UTSW	7	104141371	missense	probably benign	0.12
R7733:Ubqln3	UTSW	7	104141076	missense	probably damaging	0.98
R7764:Ubqln3	UTSW	7	104141236	missense	possibly damaging	0.52
R7919:Ubqln3	UTSW	7	104141192	missense	probably benign	0.03
R7961:Ubqln3	UTSW	7	104142590	missense	probably benign	0.00
R8009:Ubqln3	UTSW	7	104142590	missense	probably benign	0.00
RF054:Ubqln3	UTSW	7	104141178	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GCAGAGGGTCACAATTCTCTG -3'
(R):5'- TGGCTCAGCTCGTTGATGAC -3'

Sequencing Primer
(F):5'- AGAGGGTCACAATTCTCTGTCCTTG -3'
(R):5'- GTTGATGACCCCTTTATCCAGG -3'

Posted On

2018-03-15