Incidental Mutation 'R6272:Ern2'
ID507397
Institutional Source Beutler Lab
Gene Symbol Ern2
Ensembl Gene ENSMUSG00000030866
Gene Nameendoplasmic reticulum (ER) to nucleus signalling 2
SynonymsIre1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6272 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location122169893-122186207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 122176646 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 408 (D408E)
Ref Sequence ENSEMBL: ENSMUSP00000033153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033153] [ENSMUST00000206198]
Predicted Effect probably benign
Transcript: ENSMUST00000033153
AA Change: D408E

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000033153
Gene: ENSMUSG00000030866
AA Change: D408E

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
PQQ 33 64 5.5e-8 SMART
PQQ 115 147 4.7e-4 SMART
PQQ 148 180 6.1e-2 SMART
PQQ 192 223 6.2e-3 SMART
low complexity region 449 461 N/A INTRINSIC
S_TKc 508 768 2.5e-11 SMART
PUG 831 888 9e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206198
AA Change: D408E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Mice homozygous for disruption of this gene are generally normal but display an increased susceptibility to intestinal inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 A T 5: 50,009,449 M187K possibly damaging Het
Adgrg3 A G 8: 95,036,261 I189V noncoding transcript Het
Ampd1 A G 3: 103,085,383 K147R possibly damaging Het
Apbb2 T C 5: 66,311,072 T561A probably damaging Het
Arfgef3 A T 10: 18,646,963 D438E probably benign Het
Atxn1 T A 13: 45,567,762 Q219L possibly damaging Het
AW551984 A T 9: 39,598,037 D269E probably benign Het
Cryab A G 9: 50,754,525 K72R possibly damaging Het
Dbn1 G A 13: 55,475,104 A522V probably benign Het
Dip2a A T 10: 76,286,407 *158R probably null Het
Edrf1 C T 7: 133,637,808 probably benign Het
F830016B08Rik T C 18: 60,300,078 S78P probably damaging Het
Fah C A 7: 84,595,545 G137C probably damaging Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Foxd3 A G 4: 99,656,740 D39G probably damaging Het
Gm3854 C T 7: 6,353,845 P219L probably damaging Het
Gprin3 G A 6: 59,353,331 Q664* probably null Het
H2-Ob T C 17: 34,242,644 I119T probably benign Het
Hist1h3e A T 13: 23,562,226 V47E probably damaging Het
Hmgcll1 G A 9: 76,130,345 G174R probably damaging Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kynu A T 2: 43,634,989 N315Y probably benign Het
Map1lc3b G A 8: 121,596,690 E100K probably benign Het
Matn2 T A 15: 34,355,607 Q33L possibly damaging Het
Mettl8 T C 2: 70,976,075 probably null Het
Neto1 A T 18: 86,494,815 N312Y probably damaging Het
Nhsl1 A G 10: 18,524,505 D493G probably benign Het
Nup210l A G 3: 90,170,024 E889G possibly damaging Het
Olfr1153 G A 2: 87,896,657 V153I probably benign Het
Olfr1383 C A 11: 49,524,126 S134R possibly damaging Het
Olfr1402 A G 3: 97,410,891 F97L probably benign Het
Olfr209 A C 16: 59,361,585 M211R possibly damaging Het
Olfr296-ps1 A G 7: 86,561,873 Y47C unknown Het
Olfr420 C T 1: 174,159,175 T134I probably benign Het
Olfr967 A T 9: 39,750,520 M45L probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Phc2 A G 4: 128,709,647 Y190C probably damaging Het
Platr25 T C 13: 62,672,997 T347A possibly damaging Het
Plec T C 15: 76,174,853 E3655G probably damaging Het
Plekhg3 A T 12: 76,576,845 Q954L probably benign Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Prdm4 G A 10: 85,907,830 T187I possibly damaging Het
Prg4 T C 1: 150,454,766 probably benign Het
Prpf18 G A 2: 4,633,447 R312W probably damaging Het
Rnf213 T A 11: 119,414,548 V535D probably damaging Het
Rtcb A T 10: 85,955,774 N39K probably damaging Het
Slc4a3 G A 1: 75,554,697 probably null Het
Szt2 A C 4: 118,374,290 probably benign Het
Tfap2e A T 4: 126,721,864 V259D probably damaging Het
Trav19 A G 14: 53,845,798 D110G probably damaging Het
Ttc17 A C 2: 94,358,755 C749W probably damaging Het
Ttc8 A G 12: 98,982,494 K490E possibly damaging Het
Ube4b A G 4: 149,387,133 S99P probably damaging Het
Ubqln3 C T 7: 104,142,178 R235H probably damaging Het
Vmn2r61 A T 7: 42,299,818 D554V probably damaging Het
Vmn2r70 A T 7: 85,558,986 V761E probably damaging Het
Vmn2r97 T C 17: 18,947,599 I705T possibly damaging Het
Wwox G A 8: 114,488,952 C155Y probably damaging Het
Zfp451 T C 1: 33,803,244 probably benign Het
Other mutations in Ern2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ern2 APN 7 122170092 missense probably damaging 0.99
IGL01324:Ern2 APN 7 122183190 missense possibly damaging 0.88
IGL02185:Ern2 APN 7 122173375 splice site probably benign
IGL02738:Ern2 APN 7 122182899 missense probably damaging 0.99
IGL02750:Ern2 APN 7 122181406 splice site probably benign
IGL03247:Ern2 APN 7 122171671 missense probably benign 0.02
ernie UTSW 7 122171661 critical splice donor site probably null
Ernie2 UTSW 7 122180862 splice site probably benign
ernie3 UTSW 7 122173819 critical splice acceptor site probably null
R0165:Ern2 UTSW 7 122179779 missense probably benign 0.02
R0785:Ern2 UTSW 7 122171661 critical splice donor site probably null
R0801:Ern2 UTSW 7 122180862 splice site probably benign
R1345:Ern2 UTSW 7 122177770 missense probably damaging 1.00
R1649:Ern2 UTSW 7 122177400 missense probably damaging 1.00
R1747:Ern2 UTSW 7 122173819 critical splice acceptor site probably null
R1747:Ern2 UTSW 7 122173820 critical splice acceptor site probably null
R1846:Ern2 UTSW 7 122176536 missense probably benign 0.32
R1899:Ern2 UTSW 7 122183842 splice site probably benign
R1986:Ern2 UTSW 7 122171529 missense probably benign 0.06
R2055:Ern2 UTSW 7 122183945 missense possibly damaging 0.84
R2329:Ern2 UTSW 7 122173487 missense possibly damaging 0.82
R2351:Ern2 UTSW 7 122171508 missense probably damaging 0.97
R2894:Ern2 UTSW 7 122181587 missense possibly damaging 0.94
R3176:Ern2 UTSW 7 122180964 missense possibly damaging 0.89
R3276:Ern2 UTSW 7 122180964 missense possibly damaging 0.89
R3945:Ern2 UTSW 7 122176530 missense probably benign 0.10
R4303:Ern2 UTSW 7 122177846 critical splice acceptor site probably null
R4874:Ern2 UTSW 7 122176587 missense probably benign 0.28
R4943:Ern2 UTSW 7 122173258 missense possibly damaging 0.95
R5184:Ern2 UTSW 7 122179959 missense probably benign 0.03
R5629:Ern2 UTSW 7 122170166 missense probably damaging 1.00
R5770:Ern2 UTSW 7 122179907 missense possibly damaging 0.92
R6255:Ern2 UTSW 7 122173272 missense probably damaging 1.00
R6277:Ern2 UTSW 7 122186107 missense probably benign
R6624:Ern2 UTSW 7 122177783 missense probably benign 0.00
R6940:Ern2 UTSW 7 122186146 missense probably benign 0.01
R7491:Ern2 UTSW 7 122170533 missense probably damaging 1.00
R7544:Ern2 UTSW 7 122173199 missense probably benign 0.06
R7555:Ern2 UTSW 7 122170241 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTAGAGCTTGGACTCCC -3'
(R):5'- CAGAATCATGGACAGCACGATG -3'

Sequencing Primer
(F):5'- AGCTTGGACTCCCAGAGCATAG -3'
(R):5'- TCATGGACAGCACGATGTAGCC -3'
Posted On2018-03-15