Incidental Mutation 'R6272:Kbtbd11'
ID507399
Institutional Source Beutler Lab
Gene Symbol Kbtbd11
Ensembl Gene ENSMUSG00000055675
Gene Namekelch repeat and BTB (POZ) domain containing 11
Synonyms4930465M17Rik, 2900016B01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6272 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location15011025-15033333 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 15029118 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 572 (C572*)
Ref Sequence ENSEMBL: ENSMUSP00000139292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069399] [ENSMUST00000183471]
Predicted Effect probably null
Transcript: ENSMUST00000069399
AA Change: C572*
SMART Domains Protein: ENSMUSP00000068321
Gene: ENSMUSG00000055675
AA Change: C572*

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 88 114 N/A INTRINSIC
BTB 146 237 1.74e-15 SMART
low complexity region 289 311 N/A INTRINSIC
Blast:BTB 318 358 2e-16 BLAST
Kelch 366 418 5.26e-3 SMART
Kelch 419 463 4.65e-4 SMART
Kelch 464 506 1.71e-1 SMART
low complexity region 524 532 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183471
AA Change: C572*
SMART Domains Protein: ENSMUSP00000139292
Gene: ENSMUSG00000055675
AA Change: C572*

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 88 114 N/A INTRINSIC
BTB 146 237 1.74e-15 SMART
low complexity region 289 311 N/A INTRINSIC
Blast:BTB 318 358 2e-16 BLAST
Kelch 366 418 5.26e-3 SMART
Kelch 419 463 4.65e-4 SMART
Kelch 464 506 1.71e-1 SMART
low complexity region 524 532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192473
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 A T 5: 50,009,449 M187K possibly damaging Het
Adgrg3 A G 8: 95,036,261 I189V noncoding transcript Het
Ampd1 A G 3: 103,085,383 K147R possibly damaging Het
Apbb2 T C 5: 66,311,072 T561A probably damaging Het
Arfgef3 A T 10: 18,646,963 D438E probably benign Het
Atxn1 T A 13: 45,567,762 Q219L possibly damaging Het
AW551984 A T 9: 39,598,037 D269E probably benign Het
Cryab A G 9: 50,754,525 K72R possibly damaging Het
Dbn1 G A 13: 55,475,104 A522V probably benign Het
Dip2a A T 10: 76,286,407 *158R probably null Het
Edrf1 C T 7: 133,637,808 probably benign Het
Ern2 A T 7: 122,176,646 D408E probably benign Het
F830016B08Rik T C 18: 60,300,078 S78P probably damaging Het
Fah C A 7: 84,595,545 G137C probably damaging Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Foxd3 A G 4: 99,656,740 D39G probably damaging Het
Gm3854 C T 7: 6,353,845 P219L probably damaging Het
Gprin3 G A 6: 59,353,331 Q664* probably null Het
H2-Ob T C 17: 34,242,644 I119T probably benign Het
Hist1h3e A T 13: 23,562,226 V47E probably damaging Het
Hmgcll1 G A 9: 76,130,345 G174R probably damaging Het
Kynu A T 2: 43,634,989 N315Y probably benign Het
Map1lc3b G A 8: 121,596,690 E100K probably benign Het
Matn2 T A 15: 34,355,607 Q33L possibly damaging Het
Mettl8 T C 2: 70,976,075 probably null Het
Neto1 A T 18: 86,494,815 N312Y probably damaging Het
Nhsl1 A G 10: 18,524,505 D493G probably benign Het
Nup210l A G 3: 90,170,024 E889G possibly damaging Het
Olfr1153 G A 2: 87,896,657 V153I probably benign Het
Olfr1383 C A 11: 49,524,126 S134R possibly damaging Het
Olfr1402 A G 3: 97,410,891 F97L probably benign Het
Olfr209 A C 16: 59,361,585 M211R possibly damaging Het
Olfr296-ps1 A G 7: 86,561,873 Y47C unknown Het
Olfr420 C T 1: 174,159,175 T134I probably benign Het
Olfr967 A T 9: 39,750,520 M45L probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Phc2 A G 4: 128,709,647 Y190C probably damaging Het
Platr25 T C 13: 62,672,997 T347A possibly damaging Het
Plec T C 15: 76,174,853 E3655G probably damaging Het
Plekhg3 A T 12: 76,576,845 Q954L probably benign Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Prdm4 G A 10: 85,907,830 T187I possibly damaging Het
Prg4 T C 1: 150,454,766 probably benign Het
Prpf18 G A 2: 4,633,447 R312W probably damaging Het
Rnf213 T A 11: 119,414,548 V535D probably damaging Het
Rtcb A T 10: 85,955,774 N39K probably damaging Het
Slc4a3 G A 1: 75,554,697 probably null Het
Szt2 A C 4: 118,374,290 probably benign Het
Tfap2e A T 4: 126,721,864 V259D probably damaging Het
Trav19 A G 14: 53,845,798 D110G probably damaging Het
Ttc17 A C 2: 94,358,755 C749W probably damaging Het
Ttc8 A G 12: 98,982,494 K490E possibly damaging Het
Ube4b A G 4: 149,387,133 S99P probably damaging Het
Ubqln3 C T 7: 104,142,178 R235H probably damaging Het
Vmn2r61 A T 7: 42,299,818 D554V probably damaging Het
Vmn2r70 A T 7: 85,558,986 V761E probably damaging Het
Vmn2r97 T C 17: 18,947,599 I705T possibly damaging Het
Wwox G A 8: 114,488,952 C155Y probably damaging Het
Zfp451 T C 1: 33,803,244 probably benign Het
Other mutations in Kbtbd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Kbtbd11 APN 8 15029176 missense probably damaging 1.00
IGL02160:Kbtbd11 APN 8 15028801 missense probably damaging 1.00
IGL02538:Kbtbd11 APN 8 15028841 missense probably damaging 1.00
IGL03039:Kbtbd11 APN 8 15027467 missense probably benign 0.00
R0152:Kbtbd11 UTSW 8 15027428 missense probably damaging 0.96
R0242:Kbtbd11 UTSW 8 15027508 missense probably benign
R0242:Kbtbd11 UTSW 8 15027508 missense probably benign
R0453:Kbtbd11 UTSW 8 15027499 missense probably benign 0.01
R0498:Kbtbd11 UTSW 8 15027605 missense probably benign
R0629:Kbtbd11 UTSW 8 15027572 missense probably benign
R2031:Kbtbd11 UTSW 8 15028021 missense possibly damaging 0.87
R2214:Kbtbd11 UTSW 8 15029178 missense possibly damaging 0.85
R3720:Kbtbd11 UTSW 8 15029118 nonsense probably null
R3722:Kbtbd11 UTSW 8 15029118 nonsense probably null
R4355:Kbtbd11 UTSW 8 15028578 missense probably damaging 1.00
R4658:Kbtbd11 UTSW 8 15028917 missense possibly damaging 0.59
R5037:Kbtbd11 UTSW 8 15027886 missense probably benign 0.25
R5312:Kbtbd11 UTSW 8 15028589 missense possibly damaging 0.92
R5936:Kbtbd11 UTSW 8 15027534 missense probably benign 0.00
R6056:Kbtbd11 UTSW 8 15027577 missense probably benign
R6547:Kbtbd11 UTSW 8 15027641 missense possibly damaging 0.83
R7126:Kbtbd11 UTSW 8 15028759 missense probably damaging 1.00
R7359:Kbtbd11 UTSW 8 15028858 missense probably damaging 1.00
Z1088:Kbtbd11 UTSW 8 15027839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTACCGCCTGCTCAAGTAC -3'
(R):5'- GATCCTGTCCTAGACTGCAC -3'

Sequencing Primer
(F):5'- GCCTGCTCAAGTACGACCC -3'
(R):5'- GTCCTAGACTGCACCCTGC -3'
Posted On2018-03-15