Incidental Mutation 'R6272:Atxn1'
ID507416
Institutional Source Beutler Lab
Gene Symbol Atxn1
Ensembl Gene ENSMUSG00000046876
Gene Nameataxin 1
Synonyms2900016G23Rik, Atx1, Sca1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6272 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location45549755-45965008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45567762 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 219 (Q219L)
Ref Sequence ENSEMBL: ENSMUSP00000137439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091628] [ENSMUST00000167708] [ENSMUST00000180110]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091628
AA Change: Q219L

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000089217
Gene: ENSMUSG00000046876
AA Change: Q219L

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
Pfam:ATXN-1_C 391 421 8.7e-15 PFAM
AXH 545 664 1.42e-82 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167708
AA Change: Q219L

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129890
Gene: ENSMUSG00000046876
AA Change: Q219L

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
Pfam:ATXN-1_C 391 421 8.7e-15 PFAM
AXH 545 664 1.42e-82 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000180110
AA Change: Q219L

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137439
Gene: ENSMUSG00000046876
AA Change: Q219L

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
Pfam:ATXN-1_C 402 421 3e-10 PFAM
low complexity region 537 548 N/A INTRINSIC
Pfam:AXH 550 671 1.1e-44 PFAM
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the `pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. The function of the ataxins is not known. This locus has been mapped to chromosome 6, and it has been determined that the diseased allele contains 40-83 CAG repeats, compared to 6-39 in the normal allele, and is associated with spinocerebellar ataxia type 1 (SCA1). At least two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased exploration, impaired spatial working memory, impaired coordination, and decreased paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 A T 5: 50,009,449 M187K possibly damaging Het
Adgrg3 A G 8: 95,036,261 I189V noncoding transcript Het
Ampd1 A G 3: 103,085,383 K147R possibly damaging Het
Apbb2 T C 5: 66,311,072 T561A probably damaging Het
Arfgef3 A T 10: 18,646,963 D438E probably benign Het
AW551984 A T 9: 39,598,037 D269E probably benign Het
Cryab A G 9: 50,754,525 K72R possibly damaging Het
Dbn1 G A 13: 55,475,104 A522V probably benign Het
Dip2a A T 10: 76,286,407 *158R probably null Het
Edrf1 C T 7: 133,637,808 probably benign Het
Ern2 A T 7: 122,176,646 D408E probably benign Het
F830016B08Rik T C 18: 60,300,078 S78P probably damaging Het
Fah C A 7: 84,595,545 G137C probably damaging Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Foxd3 A G 4: 99,656,740 D39G probably damaging Het
Gm3854 C T 7: 6,353,845 P219L probably damaging Het
Gprin3 G A 6: 59,353,331 Q664* probably null Het
H2-Ob T C 17: 34,242,644 I119T probably benign Het
Hist1h3e A T 13: 23,562,226 V47E probably damaging Het
Hmgcll1 G A 9: 76,130,345 G174R probably damaging Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kynu A T 2: 43,634,989 N315Y probably benign Het
Map1lc3b G A 8: 121,596,690 E100K probably benign Het
Matn2 T A 15: 34,355,607 Q33L possibly damaging Het
Mettl8 T C 2: 70,976,075 probably null Het
Neto1 A T 18: 86,494,815 N312Y probably damaging Het
Nhsl1 A G 10: 18,524,505 D493G probably benign Het
Nup210l A G 3: 90,170,024 E889G possibly damaging Het
Olfr1153 G A 2: 87,896,657 V153I probably benign Het
Olfr1383 C A 11: 49,524,126 S134R possibly damaging Het
Olfr1402 A G 3: 97,410,891 F97L probably benign Het
Olfr209 A C 16: 59,361,585 M211R possibly damaging Het
Olfr296-ps1 A G 7: 86,561,873 Y47C unknown Het
Olfr420 C T 1: 174,159,175 T134I probably benign Het
Olfr967 A T 9: 39,750,520 M45L probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Phc2 A G 4: 128,709,647 Y190C probably damaging Het
Platr25 T C 13: 62,672,997 T347A possibly damaging Het
Plec T C 15: 76,174,853 E3655G probably damaging Het
Plekhg3 A T 12: 76,576,845 Q954L probably benign Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Prdm4 G A 10: 85,907,830 T187I possibly damaging Het
Prg4 T C 1: 150,454,766 probably benign Het
Prpf18 G A 2: 4,633,447 R312W probably damaging Het
Rnf213 T A 11: 119,414,548 V535D probably damaging Het
Rtcb A T 10: 85,955,774 N39K probably damaging Het
Slc4a3 G A 1: 75,554,697 probably null Het
Szt2 A C 4: 118,374,290 probably benign Het
Tfap2e A T 4: 126,721,864 V259D probably damaging Het
Trav19 A G 14: 53,845,798 D110G probably damaging Het
Ttc17 A C 2: 94,358,755 C749W probably damaging Het
Ttc8 A G 12: 98,982,494 K490E possibly damaging Het
Ube4b A G 4: 149,387,133 S99P probably damaging Het
Ubqln3 C T 7: 104,142,178 R235H probably damaging Het
Vmn2r61 A T 7: 42,299,818 D554V probably damaging Het
Vmn2r70 A T 7: 85,558,986 V761E probably damaging Het
Vmn2r97 T C 17: 18,947,599 I705T possibly damaging Het
Wwox G A 8: 114,488,952 C155Y probably damaging Het
Zfp451 T C 1: 33,803,244 probably benign Het
Other mutations in Atxn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Atxn1 APN 13 45568427 utr 5 prime probably benign
IGL01467:Atxn1 APN 13 45567193 missense probably damaging 1.00
IGL01482:Atxn1 APN 13 45557314 missense probably benign 0.00
IGL01512:Atxn1 APN 13 45566601 missense probably damaging 0.99
IGL01735:Atxn1 APN 13 45566722 missense probably damaging 1.00
IGL02005:Atxn1 APN 13 45568225 missense probably benign 0.00
IGL02333:Atxn1 APN 13 45567204 missense probably damaging 1.00
Cormorant UTSW 13 45557069 missense probably damaging 1.00
pelagic UTSW 13 45566812 missense probably benign 0.05
R0136:Atxn1 UTSW 13 45567169 missense probably damaging 0.99
R0180:Atxn1 UTSW 13 45557548 missense probably damaging 1.00
R0299:Atxn1 UTSW 13 45567169 missense probably damaging 0.99
R0540:Atxn1 UTSW 13 45557530 missense probably damaging 1.00
R1220:Atxn1 UTSW 13 45557423 missense probably benign 0.08
R1484:Atxn1 UTSW 13 45557576 nonsense probably null
R1532:Atxn1 UTSW 13 45566910 missense possibly damaging 0.95
R1885:Atxn1 UTSW 13 45567804 missense probably benign 0.27
R2277:Atxn1 UTSW 13 45557068 missense probably damaging 0.99
R2847:Atxn1 UTSW 13 45566699 missense probably damaging 1.00
R2849:Atxn1 UTSW 13 45566699 missense probably damaging 1.00
R4326:Atxn1 UTSW 13 45965967 unclassified probably benign
R4626:Atxn1 UTSW 13 45567099 missense probably damaging 1.00
R4768:Atxn1 UTSW 13 45557548 missense probably damaging 1.00
R4944:Atxn1 UTSW 13 45566931 missense probably damaging 1.00
R5011:Atxn1 UTSW 13 45557069 missense probably damaging 1.00
R5061:Atxn1 UTSW 13 45557093 missense probably damaging 1.00
R5293:Atxn1 UTSW 13 45568368 missense probably damaging 1.00
R5299:Atxn1 UTSW 13 45557254 missense probably benign 0.14
R5561:Atxn1 UTSW 13 45566871 missense possibly damaging 0.49
R5667:Atxn1 UTSW 13 45557377 missense probably benign 0.17
R6092:Atxn1 UTSW 13 45566812 missense probably benign 0.05
R6372:Atxn1 UTSW 13 45557456 missense probably damaging 1.00
R6688:Atxn1 UTSW 13 45567671 missense probably damaging 0.99
R6997:Atxn1 UTSW 13 45567619 missense probably benign 0.04
R7041:Atxn1 UTSW 13 45566835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCGAGGAACAAAGTGGC -3'
(R):5'- TGATCTCCCCATCAGGCAAC -3'

Sequencing Primer
(F):5'- GAACAAAGTGGCCTCCGG -3'
(R):5'- TCACCAGTGCAGTAGCCTCAG -3'
Posted On2018-03-15