Incidental Mutation 'R6273:Pik3c2b'
ID507431
Institutional Source Beutler Lab
Gene Symbol Pik3c2b
Ensembl Gene ENSMUSG00000026447
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
SynonymsC330011J12Rik, PI3K-C2beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R6273 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location133045667-133108687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133066711 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 138 (S138P)
Ref Sequence ENSEMBL: ENSMUSP00000115469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077730] [ENSMUST00000153707]
Predicted Effect probably benign
Transcript: ENSMUST00000077730
AA Change: S138P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: S138P

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
PI3K_rbd 363 465 2.15e-19 SMART
PI3K_C2 618 726 6.17e-29 SMART
PI3Ka 804 990 1.66e-84 SMART
PI3Kc 1078 1340 3.45e-132 SMART
PX 1364 1476 9.44e-27 SMART
low complexity region 1481 1492 N/A INTRINSIC
C2 1517 1622 1.82e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145153
Predicted Effect probably benign
Transcript: ENSMUST00000153707
AA Change: S138P

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000115469
Gene: ENSMUSG00000026447
AA Change: S138P

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186515
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (78/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,218 I99N probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ankrd31 A G 13: 96,851,673 I1065V possibly damaging Het
Aox2 A G 1: 58,339,672 T1027A probably benign Het
Atm G A 9: 53,487,922 P1593L probably benign Het
Atp13a5 T G 16: 29,348,737 I132L probably benign Het
BC035044 A G 6: 128,890,889 probably benign Het
C530008M17Rik A T 5: 76,857,721 D643V unknown Het
Cadm3 CT C 1: 173,349,124 probably benign Homo
Car3 C T 3: 14,871,617 P247S probably benign Het
Ccdc7a T C 8: 128,787,338 Y160C probably damaging Het
Cd1d1 A G 3: 86,998,257 V143A probably benign Het
Cog6 A T 3: 52,996,052 F142I probably damaging Het
Crhr1 T G 11: 104,163,856 N98K possibly damaging Het
Csf1 A G 3: 107,749,163 V72A probably damaging Het
Cwc15 T A 9: 14,510,241 I201K probably benign Het
Dgka T C 10: 128,723,646 K482R probably benign Het
Dnah7b T C 1: 46,242,316 S2846P possibly damaging Het
Dst T A 1: 34,275,266 I4199N probably damaging Het
Dusp7 A G 9: 106,373,896 T407A possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fem1a T C 17: 56,257,083 Y59H possibly damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Filip1 A T 9: 79,815,886 D1150E probably benign Het
Gabra1 A G 11: 42,140,311 V264A probably damaging Het
Gm4131 T C 14: 62,464,850 E223G probably damaging Het
Gon4l T C 3: 88,855,849 V333A probably damaging Het
Gsk3b A G 16: 38,208,046 T289A probably benign Het
Hmcn2 T C 2: 31,411,834 S2912P probably damaging Het
Htr7 A T 19: 36,041,569 probably benign Het
Ibsp A G 5: 104,310,301 T235A probably benign Het
Ints13 A T 6: 146,565,681 D116E probably damaging Het
Kctd19 T C 8: 105,385,485 N753S probably benign Het
Mdn1 A G 4: 32,715,979 N2054D probably benign Het
Mink1 A T 11: 70,611,435 K880* probably null Het
Mrvi1 G T 7: 110,871,583 H848N probably benign Het
Myo15b T A 11: 115,862,799 L824Q possibly damaging Het
Napepld T C 5: 21,665,322 E366G probably benign Het
Obscn T A 11: 59,076,993 T2662S possibly damaging Het
Olfr130 T G 17: 38,067,795 L208R probably damaging Het
Olfr1302 T C 2: 111,781,222 F301L probably benign Het
Olfr133 T A 17: 38,148,942 M118K possibly damaging Het
Olfr1448 A G 19: 12,919,400 V303A probably benign Het
Olfr213 A G 6: 116,541,316 T288A possibly damaging Het
Olfr656 A G 7: 104,617,895 D72G probably damaging Het
Pah T C 10: 87,576,215 probably null Het
Panx3 T G 9: 37,667,429 I85L probably benign Het
Pate4 T C 9: 35,607,790 N94D probably benign Het
Pde4d A G 13: 109,950,221 M610V possibly damaging Het
Pkn1 T C 8: 83,672,270 N696S probably damaging Het
Plppr2 A G 9: 21,944,505 E258G probably damaging Het
Plxnd1 A T 6: 115,978,492 M538K probably damaging Het
Prepl G T 17: 85,083,268 N87K probably benign Het
Prkag2 C A 5: 24,947,536 R190L probably damaging Het
Rara A G 11: 98,970,222 T179A probably benign Het
Rfx7 A G 9: 72,616,997 K490E possibly damaging Het
Rgsl1 C T 1: 153,827,465 V147M possibly damaging Het
Rph3a A G 5: 120,945,422 I595T possibly damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc8a2 T C 7: 16,145,334 F582L possibly damaging Het
Sprr2e A G 3: 92,352,864 M1V probably null Het
Steap1 T A 5: 5,740,827 R40S possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thsd7a A T 6: 12,408,836 V729E probably damaging Het
Tmem2 T A 19: 21,802,005 V393E probably damaging Het
Tmprss13 A G 9: 45,345,332 Y525C probably damaging Het
Tnik A T 3: 28,577,500 H383L possibly damaging Het
Vars T C 17: 35,013,743 L881S probably damaging Het
Vmn1r201 A C 13: 22,475,215 S200R probably damaging Het
Vmn2r14 A T 5: 109,221,267 W147R probably benign Het
Vmn2r-ps130 A T 17: 23,076,785 H643L probably benign Het
Vps53 T C 11: 76,102,018 E367G probably benign Het
Xab2 C T 8: 3,611,822 G544S probably damaging Het
Ythdf3 T A 3: 16,204,856 V400E possibly damaging Het
Zfand5 C T 19: 21,279,696 P147S probably benign Het
Zfp768 A T 7: 127,345,147 probably null Het
Zswim8 A G 14: 20,713,453 M423V probably benign Het
Other mutations in Pik3c2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Pik3c2b APN 1 133091618 missense probably damaging 0.98
IGL01288:Pik3c2b APN 1 133094805 missense probably damaging 0.96
IGL01313:Pik3c2b APN 1 133071631 nonsense probably null
IGL01367:Pik3c2b APN 1 133105988 missense probably benign 0.02
IGL02379:Pik3c2b APN 1 133094791 missense probably damaging 1.00
IGL02638:Pik3c2b APN 1 133077318 splice site probably benign
IGL02728:Pik3c2b APN 1 133092327 missense probably benign 0.09
IGL02992:Pik3c2b APN 1 133066980 nonsense probably null
IGL03121:Pik3c2b APN 1 133079745 missense probably benign 0.00
R0453:Pik3c2b UTSW 1 133077396 missense probably damaging 1.00
R0518:Pik3c2b UTSW 1 133105992 missense probably damaging 1.00
R0616:Pik3c2b UTSW 1 133100831 missense probably damaging 1.00
R0659:Pik3c2b UTSW 1 133071200 missense probably damaging 0.99
R1542:Pik3c2b UTSW 1 133090034 missense probably damaging 1.00
R1716:Pik3c2b UTSW 1 133094826 missense probably damaging 1.00
R1728:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1729:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1730:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1739:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1762:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1783:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1784:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1785:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1816:Pik3c2b UTSW 1 133101370 missense probably benign 0.00
R1897:Pik3c2b UTSW 1 133066916 missense possibly damaging 0.57
R2006:Pik3c2b UTSW 1 133066544 missense probably damaging 1.00
R2067:Pik3c2b UTSW 1 133099611 missense probably damaging 1.00
R2271:Pik3c2b UTSW 1 133103428 missense probably benign
R2294:Pik3c2b UTSW 1 133066775 missense probably damaging 1.00
R2320:Pik3c2b UTSW 1 133103413 missense probably damaging 1.00
R4735:Pik3c2b UTSW 1 133067049 missense probably benign 0.25
R4926:Pik3c2b UTSW 1 133099626 nonsense probably null
R4948:Pik3c2b UTSW 1 133099715 critical splice donor site probably null
R4997:Pik3c2b UTSW 1 133105081 missense probably damaging 1.00
R5304:Pik3c2b UTSW 1 133070408 missense possibly damaging 0.50
R5461:Pik3c2b UTSW 1 133099702 missense possibly damaging 0.66
R5722:Pik3c2b UTSW 1 133103836 missense probably damaging 1.00
R5971:Pik3c2b UTSW 1 133074627 splice site probably null
R5980:Pik3c2b UTSW 1 133088308 missense probably benign 0.43
R6036:Pik3c2b UTSW 1 133090713 missense possibly damaging 0.95
R6138:Pik3c2b UTSW 1 133074627 splice site probably null
R6223:Pik3c2b UTSW 1 133070357 missense probably damaging 1.00
R6742:Pik3c2b UTSW 1 133075821 missense probably benign
R6954:Pik3c2b UTSW 1 133066303 missense possibly damaging 0.50
R6998:Pik3c2b UTSW 1 133102372 missense probably benign 0.23
R7103:Pik3c2b UTSW 1 133105974 missense probably damaging 1.00
R7133:Pik3c2b UTSW 1 133090234 missense possibly damaging 0.73
R7161:Pik3c2b UTSW 1 133106112 missense probably damaging 0.98
R7183:Pik3c2b UTSW 1 133066465 missense probably benign 0.00
R7193:Pik3c2b UTSW 1 133079774 missense probably benign 0.00
R7252:Pik3c2b UTSW 1 133094734 missense probably benign 0.19
R7263:Pik3c2b UTSW 1 133090202 missense probably damaging 0.98
R7404:Pik3c2b UTSW 1 133090706 missense probably damaging 1.00
R7709:Pik3c2b UTSW 1 133079841 critical splice donor site probably null
R7712:Pik3c2b UTSW 1 133085611 missense probably damaging 1.00
R7823:Pik3c2b UTSW 1 133102305 missense probably damaging 1.00
R7831:Pik3c2b UTSW 1 133071242 missense possibly damaging 0.94
R7913:Pik3c2b UTSW 1 133090061 critical splice donor site probably null
R7916:Pik3c2b UTSW 1 133100904 missense probably benign 0.30
R7960:Pik3c2b UTSW 1 133103849 missense probably damaging 1.00
R7981:Pik3c2b UTSW 1 133075809 critical splice acceptor site probably null
R8346:Pik3c2b UTSW 1 133090246 missense probably damaging 0.97
U15987:Pik3c2b UTSW 1 133074627 splice site probably null
X0060:Pik3c2b UTSW 1 133084936 missense probably benign 0.18
Z1176:Pik3c2b UTSW 1 133066553 missense probably damaging 1.00
Z1176:Pik3c2b UTSW 1 133099686 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCTTGGACTTCTACAGCAAG -3'
(R):5'- GCTGTTCTGCCGAAGAGAAAC -3'

Sequencing Primer
(F):5'- ACCTCAAGCTCTTGCGTGG -3'
(R):5'- TTCTGCCGAAGAGAAACTGTTG -3'
Posted On2018-03-15