Mutagenetix > Incidental Mutation

Incidental Mutation 'R6273:Rgsl1'

507432

Institutional Source

Beutler Lab

Gene Symbol

Rgsl1

Ensembl Gene

ENSMUSG00000042641

Gene Name

regulator of G-protein signaling like 1

Synonyms

Rgsl2, 4930415K13Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6273 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

153779381-153844142 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 153827465 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 147 (V147M)

Ref Sequence

ENSEMBL: ENSMUSP00000135642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124558] [ENSMUST00000185164]

AlphaFold

A0A5F8MPV0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124558
AA Change: V147M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000135642
Gene: ENSMUSG00000042641
AA Change: V147M

Domain	Start	End	E-Value	Type
low complexity region	122	136	N/A	INTRINSIC
low complexity region	242	254	N/A	INTRINSIC
low complexity region	316	325	N/A	INTRINSIC
Pfam:RGS	644	754	7.1e-12	PFAM
transmembrane domain	956	973	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000184095

Predicted Effect

possibly damaging
Transcript: ENSMUST00000185164
AA Change: V182M

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000139340
Gene: ENSMUSG00000042641
AA Change: V182M

Domain	Start	End	E-Value	Type
low complexity region	157	171	N/A	INTRINSIC
low complexity region	277	289	N/A	INTRINSIC
low complexity region	351	360	N/A	INTRINSIC
Pfam:RGS	679	789	4.1e-11	PFAM

Meta Mutation Damage Score

0.1712

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

98% (78/80)

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,218	I99N	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ankrd31	A	G	13: 96,851,673	I1065V	possibly damaging	Het
Aox2	A	G	1: 58,339,672	T1027A	probably benign	Het
Atm	G	A	9: 53,487,922	P1593L	probably benign	Het
Atp13a5	T	G	16: 29,348,737	I132L	probably benign	Het
BC035044	A	G	6: 128,890,889		probably benign	Het
C530008M17Rik	A	T	5: 76,857,721	D643V	unknown	Het
Cadm3	CT	C	1: 173,349,124		probably benign	Homo
Car3	C	T	3: 14,871,617	P247S	probably benign	Het
Ccdc7a	T	C	8: 128,787,338	Y160C	probably damaging	Het
Cd1d1	A	G	3: 86,998,257	V143A	probably benign	Het
Cog6	A	T	3: 52,996,052	F142I	probably damaging	Het
Crhr1	T	G	11: 104,163,856	N98K	possibly damaging	Het
Csf1	A	G	3: 107,749,163	V72A	probably damaging	Het
Cwc15	T	A	9: 14,510,241	I201K	probably benign	Het
Dgka	T	C	10: 128,723,646	K482R	probably benign	Het
Dnah7b	T	C	1: 46,242,316	S2846P	possibly damaging	Het
Dst	T	A	1: 34,275,266	I4199N	probably damaging	Het
Dusp7	A	G	9: 106,373,896	T407A	possibly damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fem1a	T	C	17: 56,257,083	Y59H	possibly damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Filip1	A	T	9: 79,815,886	D1150E	probably benign	Het
Gabra1	A	G	11: 42,140,311	V264A	probably damaging	Het
Gm4131	T	C	14: 62,464,850	E223G	probably damaging	Het
Gon4l	T	C	3: 88,855,849	V333A	probably damaging	Het
Gsk3b	A	G	16: 38,208,046	T289A	probably benign	Het
Hmcn2	T	C	2: 31,411,834	S2912P	probably damaging	Het
Htr7	A	T	19: 36,041,569		probably benign	Het
Ibsp	A	G	5: 104,310,301	T235A	probably benign	Het
Ints13	A	T	6: 146,565,681	D116E	probably damaging	Het
Kctd19	T	C	8: 105,385,485	N753S	probably benign	Het
Mdn1	A	G	4: 32,715,979	N2054D	probably benign	Het
Mink1	A	T	11: 70,611,435	K880*	probably null	Het
Mrvi1	G	T	7: 110,871,583	H848N	probably benign	Het
Myo15b	T	A	11: 115,862,799	L824Q	possibly damaging	Het
Napepld	T	C	5: 21,665,322	E366G	probably benign	Het
Obscn	T	A	11: 59,076,993	T2662S	possibly damaging	Het
Olfr130	T	G	17: 38,067,795	L208R	probably damaging	Het
Olfr1302	T	C	2: 111,781,222	F301L	probably benign	Het
Olfr133	T	A	17: 38,148,942	M118K	possibly damaging	Het
Olfr1448	A	G	19: 12,919,400	V303A	probably benign	Het
Olfr213	A	G	6: 116,541,316	T288A	possibly damaging	Het
Olfr656	A	G	7: 104,617,895	D72G	probably damaging	Het
Pah	T	C	10: 87,576,215		probably null	Het
Panx3	T	G	9: 37,667,429	I85L	probably benign	Het
Pate4	T	C	9: 35,607,790	N94D	probably benign	Het
Pde4d	A	G	13: 109,950,221	M610V	possibly damaging	Het
Pik3c2b	T	C	1: 133,066,711	S138P	probably benign	Het
Pkn1	T	C	8: 83,672,270	N696S	probably damaging	Het
Plppr2	A	G	9: 21,944,505	E258G	probably damaging	Het
Plxnd1	A	T	6: 115,978,492	M538K	probably damaging	Het
Prepl	G	T	17: 85,083,268	N87K	probably benign	Het
Prkag2	C	A	5: 24,947,536	R190L	probably damaging	Het
Rara	A	G	11: 98,970,222	T179A	probably benign	Het
Rfx7	A	G	9: 72,616,997	K490E	possibly damaging	Het
Rph3a	A	G	5: 120,945,422	I595T	possibly damaging	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Homo
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Slc8a2	T	C	7: 16,145,334	F582L	possibly damaging	Het
Sprr2e	A	G	3: 92,352,864	M1V	probably null	Het
Steap1	T	A	5: 5,740,827	R40S	possibly damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Thsd7a	A	T	6: 12,408,836	V729E	probably damaging	Het
Tmem2	T	A	19: 21,802,005	V393E	probably damaging	Het
Tmprss13	A	G	9: 45,345,332	Y525C	probably damaging	Het
Tnik	A	T	3: 28,577,500	H383L	possibly damaging	Het
Vars	T	C	17: 35,013,743	L881S	probably damaging	Het
Vmn1r201	A	C	13: 22,475,215	S200R	probably damaging	Het
Vmn2r14	A	T	5: 109,221,267	W147R	probably benign	Het
Vmn2r-ps130	A	T	17: 23,076,785	H643L	probably benign	Het
Vps53	T	C	11: 76,102,018	E367G	probably benign	Het
Xab2	C	T	8: 3,611,822	G544S	probably damaging	Het
Ythdf3	T	A	3: 16,204,856	V400E	possibly damaging	Het
Zfand5	C	T	19: 21,279,696	P147S	probably benign	Het
Zfp768	A	T	7: 127,345,147		probably null	Het
Zswim8	A	G	14: 20,713,453	M423V	probably benign	Het

Other mutations in Rgsl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01372:Rgsl1	APN	1	153826141	missense	probably damaging	1.00
IGL02253:Rgsl1	APN	1	153793767	missense	probably damaging	1.00
IGL02345:Rgsl1	APN	1	153804009	splice site	probably null
IGL02409:Rgsl1	APN	1	153826243	missense	possibly damaging	0.53
IGL02587:Rgsl1	APN	1	153799938	missense	probably damaging	1.00
IGL02652:Rgsl1	APN	1	153825490	missense	probably damaging	1.00
IGL02797:Rgsl1	APN	1	153807708	missense	probably damaging	1.00
IGL03032:Rgsl1	APN	1	153826202	missense	possibly damaging	0.53
IGL03082:Rgsl1	APN	1	153799947	missense	possibly damaging	0.86
IGL03123:Rgsl1	APN	1	153825941	missense	probably damaging	1.00
IGL03213:Rgsl1	APN	1	153825841	missense	probably benign	0.12
IGL03410:Rgsl1	APN	1	153793755	missense	probably null	0.82
Bam	UTSW	1	153794152	missense	probably benign	0.00
Candygram	UTSW	1	153821499	nonsense	probably null
wham	UTSW	1	153802292	missense	probably benign	0.02
IGL03050:Rgsl1	UTSW	1	153825676	missense	possibly damaging	0.60
PIT4519001:Rgsl1	UTSW	1	153825970	missense	possibly damaging	0.96
R0149:Rgsl1	UTSW	1	153793764	missense	probably damaging	1.00
R0536:Rgsl1	UTSW	1	153826181	missense	probably damaging	1.00
R0633:Rgsl1	UTSW	1	153844107	missense	possibly damaging	0.72
R0726:Rgsl1	UTSW	1	153802328	missense	probably damaging	1.00
R0839:Rgsl1	UTSW	1	153802234	critical splice donor site	probably null
R1240:Rgsl1	UTSW	1	153785191	missense	probably benign	0.18
R1355:Rgsl1	UTSW	1	153807761	start codon destroyed	probably null	0.23
R1491:Rgsl1	UTSW	1	153825926	missense	possibly damaging	0.93
R1688:Rgsl1	UTSW	1	153804676	missense	probably damaging	0.98
R1694:Rgsl1	UTSW	1	153804676	missense	probably damaging	0.98
R1842:Rgsl1	UTSW	1	153799797	missense	probably damaging	1.00
R2008:Rgsl1	UTSW	1	153825905	missense	possibly damaging	0.53
R2114:Rgsl1	UTSW	1	153817549	missense	probably benign
R2116:Rgsl1	UTSW	1	153817549	missense	probably benign
R2176:Rgsl1	UTSW	1	153825268	splice site	probably benign
R2229:Rgsl1	UTSW	1	153822358	missense	possibly damaging	0.72
R2895:Rgsl1	UTSW	1	153827548	missense	probably damaging	1.00
R3923:Rgsl1	UTSW	1	153804130	critical splice acceptor site	probably null
R4001:Rgsl1	UTSW	1	153817584	missense	probably damaging	1.00
R4434:Rgsl1	UTSW	1	153802341	missense	possibly damaging	0.52
R4489:Rgsl1	UTSW	1	153827536	missense	probably benign	0.27
R4649:Rgsl1	UTSW	1	153817582	missense	probably benign	0.01
R4925:Rgsl1	UTSW	1	153812277	missense	probably benign	0.01
R4928:Rgsl1	UTSW	1	153793768	missense	probably damaging	1.00
R5045:Rgsl1	UTSW	1	153821522	nonsense	probably null
R5304:Rgsl1	UTSW	1	153827492	missense	probably damaging	0.97
R5331:Rgsl1	UTSW	1	153802292	missense	probably benign	0.02
R5373:Rgsl1	UTSW	1	153790307	missense	probably benign	0.33
R5374:Rgsl1	UTSW	1	153790307	missense	probably benign	0.33
R5566:Rgsl1	UTSW	1	153793774	missense	probably damaging	1.00
R5649:Rgsl1	UTSW	1	153825893	missense	possibly damaging	0.93
R6062:Rgsl1	UTSW	1	153799872	missense	possibly damaging	0.72
R6142:Rgsl1	UTSW	1	153812238	missense	probably benign	0.01
R6158:Rgsl1	UTSW	1	153804021	missense	possibly damaging	0.72
R6184:Rgsl1	UTSW	1	153827448	missense	probably benign	0.08
R6384:Rgsl1	UTSW	1	153827545	missense	possibly damaging	0.86
R6419:Rgsl1	UTSW	1	153822371	missense	probably damaging	0.98
R6568:Rgsl1	UTSW	1	153821546	missense	possibly damaging	0.72
R6660:Rgsl1	UTSW	1	153825766	missense	possibly damaging	0.70
R6745:Rgsl1	UTSW	1	153822317	missense	probably benign	0.18
R6892:Rgsl1	UTSW	1	153821499	nonsense	probably null
R6974:Rgsl1	UTSW	1	153799822	missense	probably damaging	1.00
R7172:Rgsl1	UTSW	1	153826220	missense	possibly damaging	0.72
R7200:Rgsl1	UTSW	1	153785199	missense	probably benign	0.33
R7275:Rgsl1	UTSW	1	153804130	critical splice acceptor site	probably null
R7313:Rgsl1	UTSW	1	153807876	critical splice acceptor site	probably null
R7341:Rgsl1	UTSW	1	153793845	missense	probably benign	0.01
R7448:Rgsl1	UTSW	1	153844101	critical splice donor site	probably null
R7662:Rgsl1	UTSW	1	153825479	missense	probably benign
R7703:Rgsl1	UTSW	1	153793864	missense	possibly damaging	0.73
R7846:Rgsl1	UTSW	1	153826037	missense	possibly damaging	0.53
R8408:Rgsl1	UTSW	1	153825689	missense	possibly damaging	0.96
R8860:Rgsl1	UTSW	1	153821354	nonsense	probably null
R8894:Rgsl1	UTSW	1	153822373	critical splice acceptor site	probably null
R9043:Rgsl1	UTSW	1	153841821	missense	possibly damaging	0.73
R9187:Rgsl1	UTSW	1	153793867	missense	possibly damaging	0.53
R9280:Rgsl1	UTSW	1	153794152	missense	probably benign	0.00
R9326:Rgsl1	UTSW	1	153804022	missense	probably benign	0.01
R9388:Rgsl1	UTSW	1	153817609	missense	probably benign
R9479:Rgsl1	UTSW	1	153781699	missense	unknown
X0020:Rgsl1	UTSW	1	153825385	missense	probably benign	0.33
X0065:Rgsl1	UTSW	1	153804033	missense	possibly damaging	0.84
Z1177:Rgsl1	UTSW	1	153817610	missense	possibly damaging	0.70
Z1177:Rgsl1	UTSW	1	153825988	missense	not run

Predicted Primers

PCR Primer
(F):5'- TAAGCACCATCCTAAACATGGCTG -3'
(R):5'- AGTGTGCAGCTCTCCATCTC -3'

Sequencing Primer
(F):5'- ATCCTAAACATGGCTGGTGTC -3'
(R):5'- TCTCCTGTCTGACCTGTAGG -3'

Posted On

2018-03-15