Mutagenetix > Incidental Mutation

Incidental Mutation 'R6273:Tnik'

507439

Institutional Source

Beutler Lab

Gene Symbol

Tnik

Ensembl Gene

ENSMUSG00000027692

Gene Name

TRAF2 and NCK interacting kinase

Synonyms

C630040K21Rik, 1500031A17Rik, 4831440I19Rik, C530008O15Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6273 (G1)

Quality Score

81.0075

Status

Validated

Chromosome

Chromosomal Location

28263214-28675858 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 28577500 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 383 (H383L)

Ref Sequence

ENSEMBL: ENSMUSP00000124726 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159236] [ENSMUST00000159308] [ENSMUST00000159680] [ENSMUST00000160307] [ENSMUST00000160518] [ENSMUST00000160934] [ENSMUST00000161964] [ENSMUST00000162485] [ENSMUST00000162777]

AlphaFold

P83510

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159236
AA Change: H383L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000124681
Gene: ENSMUSG00000027692
AA Change: H383L

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.23e-96	SMART
low complexity region	317	340	N/A	INTRINSIC
coiled coil region	360	482	N/A	INTRINSIC
low complexity region	691	726	N/A	INTRINSIC
low complexity region	793	812	N/A	INTRINSIC
low complexity region	951	958	N/A	INTRINSIC
CNH	1005	1303	1.92e-117	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000159308
AA Change: H383L

SMART Domains

Protein: ENSMUSP00000125466
Gene: ENSMUSG00000027692
AA Change: H383L

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.23e-96	SMART
low complexity region	317	340	N/A	INTRINSIC
coiled coil region	360	482	N/A	INTRINSIC
low complexity region	636	671	N/A	INTRINSIC
low complexity region	746	765	N/A	INTRINSIC
low complexity region	904	911	N/A	INTRINSIC
CNH	958	1256	1.92e-117	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000159680
AA Change: H383L

SMART Domains

Protein: ENSMUSP00000124876
Gene: ENSMUSG00000027692
AA Change: H383L

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.23e-96	SMART
low complexity region	317	340	N/A	INTRINSIC
coiled coil region	360	511	N/A	INTRINSIC
low complexity region	720	755	N/A	INTRINSIC
low complexity region	822	841	N/A	INTRINSIC
low complexity region	980	987	N/A	INTRINSIC
CNH	1034	1332	1.92e-117	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000160307
AA Change: H383L

SMART Domains

Protein: ENSMUSP00000125081
Gene: ENSMUSG00000027692
AA Change: H383L

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.23e-96	SMART
low complexity region	317	340	N/A	INTRINSIC
coiled coil region	360	511	N/A	INTRINSIC
low complexity region	720	755	N/A	INTRINSIC
low complexity region	830	849	N/A	INTRINSIC
low complexity region	988	995	N/A	INTRINSIC
CNH	1042	1340	1.92e-117	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000160518
AA Change: H383L

SMART Domains

Protein: ENSMUSP00000124011
Gene: ENSMUSG00000027692
AA Change: H383L

Domain	Start	End	E-Value	Type
S_TKc	25	289	5.9e-99	SMART
low complexity region	317	340	N/A	INTRINSIC
coiled coil region	360	482	N/A	INTRINSIC
low complexity region	691	726	N/A	INTRINSIC
low complexity region	801	820	N/A	INTRINSIC
low complexity region	959	966	N/A	INTRINSIC
CNH	1013	1311	9.3e-120	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160934

SMART Domains

Protein: ENSMUSP00000123859
Gene: ENSMUSG00000027692

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	25	212	2.2e-37	PFAM
Pfam:Pkinase	25	219	5.9e-52	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161423

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161964
AA Change: H383L

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000125411
Gene: ENSMUSG00000027692
AA Change: H383L

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.23e-96	SMART
low complexity region	317	340	N/A	INTRINSIC
coiled coil region	360	482	N/A	INTRINSIC
low complexity region	636	671	N/A	INTRINSIC
low complexity region	738	757	N/A	INTRINSIC
low complexity region	896	903	N/A	INTRINSIC
CNH	950	1248	1.92e-117	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162037

Predicted Effect

unknown
Transcript: ENSMUST00000162485
AA Change: H383L

SMART Domains

Protein: ENSMUSP00000124387
Gene: ENSMUSG00000027692
AA Change: H383L

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.23e-96	SMART
low complexity region	317	340	N/A	INTRINSIC
coiled coil region	360	511	N/A	INTRINSIC
low complexity region	665	700	N/A	INTRINSIC
low complexity region	775	794	N/A	INTRINSIC
low complexity region	933	940	N/A	INTRINSIC
CNH	987	1285	1.92e-117	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162777
AA Change: H383L

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000124726
Gene: ENSMUSG00000027692
AA Change: H383L

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.23e-96	SMART
low complexity region	317	340	N/A	INTRINSIC
coiled coil region	360	511	N/A	INTRINSIC
low complexity region	665	700	N/A	INTRINSIC
low complexity region	767	786	N/A	INTRINSIC
low complexity region	925	932	N/A	INTRINSIC
CNH	979	1277	1.92e-117	SMART

Meta Mutation Damage Score

0.1955

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

98% (78/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Germinal center kinases (GCKs), such as TNIK, are characterized by an N-terminal kinase domain and a C-terminal GCK domain that serves a regulatory function (Fu et al., 1999 [PubMed 10521462]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired postsynaptic signaling and cognitive function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,218	I99N	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ankrd31	A	G	13: 96,851,673	I1065V	possibly damaging	Het
Aox2	A	G	1: 58,339,672	T1027A	probably benign	Het
Atm	G	A	9: 53,487,922	P1593L	probably benign	Het
Atp13a5	T	G	16: 29,348,737	I132L	probably benign	Het
BC035044	A	G	6: 128,890,889		probably benign	Het
C530008M17Rik	A	T	5: 76,857,721	D643V	unknown	Het
Cadm3	CT	C	1: 173,349,124		probably benign	Homo
Car3	C	T	3: 14,871,617	P247S	probably benign	Het
Ccdc7a	T	C	8: 128,787,338	Y160C	probably damaging	Het
Cd1d1	A	G	3: 86,998,257	V143A	probably benign	Het
Cog6	A	T	3: 52,996,052	F142I	probably damaging	Het
Crhr1	T	G	11: 104,163,856	N98K	possibly damaging	Het
Csf1	A	G	3: 107,749,163	V72A	probably damaging	Het
Cwc15	T	A	9: 14,510,241	I201K	probably benign	Het
Dgka	T	C	10: 128,723,646	K482R	probably benign	Het
Dnah7b	T	C	1: 46,242,316	S2846P	possibly damaging	Het
Dst	T	A	1: 34,275,266	I4199N	probably damaging	Het
Dusp7	A	G	9: 106,373,896	T407A	possibly damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fem1a	T	C	17: 56,257,083	Y59H	possibly damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Filip1	A	T	9: 79,815,886	D1150E	probably benign	Het
Gabra1	A	G	11: 42,140,311	V264A	probably damaging	Het
Gm4131	T	C	14: 62,464,850	E223G	probably damaging	Het
Gon4l	T	C	3: 88,855,849	V333A	probably damaging	Het
Gsk3b	A	G	16: 38,208,046	T289A	probably benign	Het
Hmcn2	T	C	2: 31,411,834	S2912P	probably damaging	Het
Htr7	A	T	19: 36,041,569		probably benign	Het
Ibsp	A	G	5: 104,310,301	T235A	probably benign	Het
Ints13	A	T	6: 146,565,681	D116E	probably damaging	Het
Kctd19	T	C	8: 105,385,485	N753S	probably benign	Het
Mdn1	A	G	4: 32,715,979	N2054D	probably benign	Het
Mink1	A	T	11: 70,611,435	K880*	probably null	Het
Mrvi1	G	T	7: 110,871,583	H848N	probably benign	Het
Myo15b	T	A	11: 115,862,799	L824Q	possibly damaging	Het
Napepld	T	C	5: 21,665,322	E366G	probably benign	Het
Obscn	T	A	11: 59,076,993	T2662S	possibly damaging	Het
Olfr130	T	G	17: 38,067,795	L208R	probably damaging	Het
Olfr1302	T	C	2: 111,781,222	F301L	probably benign	Het
Olfr133	T	A	17: 38,148,942	M118K	possibly damaging	Het
Olfr1448	A	G	19: 12,919,400	V303A	probably benign	Het
Olfr213	A	G	6: 116,541,316	T288A	possibly damaging	Het
Olfr656	A	G	7: 104,617,895	D72G	probably damaging	Het
Pah	T	C	10: 87,576,215		probably null	Het
Panx3	T	G	9: 37,667,429	I85L	probably benign	Het
Pate4	T	C	9: 35,607,790	N94D	probably benign	Het
Pde4d	A	G	13: 109,950,221	M610V	possibly damaging	Het
Pik3c2b	T	C	1: 133,066,711	S138P	probably benign	Het
Pkn1	T	C	8: 83,672,270	N696S	probably damaging	Het
Plppr2	A	G	9: 21,944,505	E258G	probably damaging	Het
Plxnd1	A	T	6: 115,978,492	M538K	probably damaging	Het
Prepl	G	T	17: 85,083,268	N87K	probably benign	Het
Prkag2	C	A	5: 24,947,536	R190L	probably damaging	Het
Rara	A	G	11: 98,970,222	T179A	probably benign	Het
Rfx7	A	G	9: 72,616,997	K490E	possibly damaging	Het
Rgsl1	C	T	1: 153,827,465	V147M	possibly damaging	Het
Rph3a	A	G	5: 120,945,422	I595T	possibly damaging	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Homo
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Slc8a2	T	C	7: 16,145,334	F582L	possibly damaging	Het
Sprr2e	A	G	3: 92,352,864	M1V	probably null	Het
Steap1	T	A	5: 5,740,827	R40S	possibly damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Thsd7a	A	T	6: 12,408,836	V729E	probably damaging	Het
Tmem2	T	A	19: 21,802,005	V393E	probably damaging	Het
Tmprss13	A	G	9: 45,345,332	Y525C	probably damaging	Het
Vars	T	C	17: 35,013,743	L881S	probably damaging	Het
Vmn1r201	A	C	13: 22,475,215	S200R	probably damaging	Het
Vmn2r14	A	T	5: 109,221,267	W147R	probably benign	Het
Vmn2r-ps130	A	T	17: 23,076,785	H643L	probably benign	Het
Vps53	T	C	11: 76,102,018	E367G	probably benign	Het
Xab2	C	T	8: 3,611,822	G544S	probably damaging	Het
Ythdf3	T	A	3: 16,204,856	V400E	possibly damaging	Het
Zfand5	C	T	19: 21,279,696	P147S	probably benign	Het
Zfp768	A	T	7: 127,345,147		probably null	Het
Zswim8	A	G	14: 20,713,453	M423V	probably benign	Het

Other mutations in Tnik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Tnik	APN	3	28654218	missense	probably damaging	1.00
IGL00726:Tnik	APN	3	28532898	missense	probably damaging	1.00
IGL01022:Tnik	APN	3	28625228	splice site	probably null
IGL01145:Tnik	APN	3	28604167	intron	probably benign
IGL01664:Tnik	APN	3	28638479	missense	probably damaging	1.00
IGL01843:Tnik	APN	3	28570858	splice site	probably null
IGL02378:Tnik	APN	3	28638459	nonsense	probably null
IGL02448:Tnik	APN	3	28621077	missense	probably null	0.01
IGL02756:Tnik	APN	3	28542030	missense	probably damaging	1.00
IGL03332:Tnik	APN	3	28666155	missense	probably damaging	1.00
delightful	UTSW	3	28604185	missense	probably damaging	1.00
Hottie	UTSW	3	28263643	start codon destroyed	probably null	0.93
Knockout	UTSW	3	28661778	missense	possibly damaging	0.91
Looker	UTSW	3	28661704	nonsense	probably null
Lovely	UTSW	3	28611970	critical splice donor site	probably null
Usher	UTSW	3	28564097	missense	possibly damaging	0.61
R0135:Tnik	UTSW	3	28607245	missense	possibly damaging	0.67
R0418:Tnik	UTSW	3	28570880	nonsense	probably null
R0540:Tnik	UTSW	3	28650159	missense	probably damaging	1.00
R0549:Tnik	UTSW	3	28570920	missense	possibly damaging	0.87
R0556:Tnik	UTSW	3	28625218	missense	possibly damaging	0.95
R0586:Tnik	UTSW	3	28577361	splice site	probably benign
R0607:Tnik	UTSW	3	28650159	missense	probably damaging	1.00
R0842:Tnik	UTSW	3	28594086	missense	possibly damaging	0.72
R1068:Tnik	UTSW	3	28532975	missense	probably damaging	1.00
R1171:Tnik	UTSW	3	28532940	missense	probably damaging	1.00
R1597:Tnik	UTSW	3	28604269	missense	probably damaging	1.00
R1638:Tnik	UTSW	3	28665740	missense	probably damaging	0.99
R1652:Tnik	UTSW	3	28604293	missense	probably benign	0.22
R1996:Tnik	UTSW	3	28665680	missense	probably damaging	1.00
R2333:Tnik	UTSW	3	28532996	missense	probably damaging	1.00
R2426:Tnik	UTSW	3	28646681	missense	probably damaging	1.00
R2509:Tnik	UTSW	3	28667915	missense	probably damaging	1.00
R3774:Tnik	UTSW	3	28638419	missense	probably damaging	0.98
R3775:Tnik	UTSW	3	28638419	missense	probably damaging	0.98
R4007:Tnik	UTSW	3	28604281	missense	probably damaging	1.00
R4119:Tnik	UTSW	3	28666175	missense	probably damaging	1.00
R4209:Tnik	UTSW	3	28359065	splice site	probably benign
R4441:Tnik	UTSW	3	28564097	missense	possibly damaging	0.61
R4611:Tnik	UTSW	3	28542100	critical splice donor site	probably null
R4714:Tnik	UTSW	3	28594077	missense	possibly damaging	0.53
R4772:Tnik	UTSW	3	28607210	missense	probably benign	0.09
R4829:Tnik	UTSW	3	28539541	intron	probably benign
R4839:Tnik	UTSW	3	28596075	missense	possibly damaging	0.86
R4898:Tnik	UTSW	3	28650086	missense	probably damaging	1.00
R5029:Tnik	UTSW	3	28665844	splice site	probably null
R5278:Tnik	UTSW	3	28650060	missense	probably damaging	1.00
R5307:Tnik	UTSW	3	28541972	missense	probably damaging	1.00
R5330:Tnik	UTSW	3	28542018	missense	probably damaging	1.00
R5375:Tnik	UTSW	3	28594092	missense	probably benign	0.02
R5459:Tnik	UTSW	3	28661741	missense	probably damaging	1.00
R5708:Tnik	UTSW	3	28611971	critical splice donor site	probably null
R5749:Tnik	UTSW	3	28594092	missense	probably benign	0.02
R5751:Tnik	UTSW	3	28594092	missense	probably benign	0.02
R5780:Tnik	UTSW	3	28594092	missense	probably benign	0.02
R5837:Tnik	UTSW	3	28668053	unclassified	probably benign
R5969:Tnik	UTSW	3	28620948	missense	probably damaging	1.00
R6244:Tnik	UTSW	3	28650179	missense	probably damaging	1.00
R6457:Tnik	UTSW	3	28539448	missense	probably damaging	1.00
R6464:Tnik	UTSW	3	28611970	critical splice donor site	probably null
R6473:Tnik	UTSW	3	28263643	start codon destroyed	probably null	0.93
R6737:Tnik	UTSW	3	28596086	missense	possibly damaging	0.72
R7049:Tnik	UTSW	3	28661704	nonsense	probably null
R7237:Tnik	UTSW	3	28638419	missense	probably damaging	0.98
R7267:Tnik	UTSW	3	28646627	missense	probably damaging	0.99
R7445:Tnik	UTSW	3	28663909	splice site	probably null
R7499:Tnik	UTSW	3	28630594	missense	possibly damaging	0.47
R7629:Tnik	UTSW	3	28661728	missense	probably damaging	0.96
R7654:Tnik	UTSW	3	28604185	missense	probably damaging	1.00
R7886:Tnik	UTSW	3	28666139	missense	probably damaging	1.00
R8096:Tnik	UTSW	3	28661778	missense	possibly damaging	0.91
R8210:Tnik	UTSW	3	28604333	missense	possibly damaging	0.95
R8233:Tnik	UTSW	3	28554937	missense	unknown
R8386:Tnik	UTSW	3	28263674	missense	unknown
R8399:Tnik	UTSW	3	28494010	missense	unknown
R8490:Tnik	UTSW	3	28596172	missense	probably damaging	0.97
R8539:Tnik	UTSW	3	28542003	missense	probably damaging	1.00
R8751:Tnik	UTSW	3	28611908	missense	probably damaging	0.98
R8804:Tnik	UTSW	3	28594053	missense	unknown
R8966:Tnik	UTSW	3	28532895	missense	unknown
R8998:Tnik	UTSW	3	28665771	missense	probably damaging	1.00
R8999:Tnik	UTSW	3	28665771	missense	probably damaging	1.00
R9016:Tnik	UTSW	3	28638395	missense	probably damaging	1.00
R9154:Tnik	UTSW	3	28650086	missense	probably damaging	0.99
R9284:Tnik	UTSW	3	28539421	missense	unknown
R9290:Tnik	UTSW	3	28620975	missense	probably benign	0.00
R9411:Tnik	UTSW	3	28630605	missense	probably damaging	1.00
R9484:Tnik	UTSW	3	28594944	missense	unknown
X0022:Tnik	UTSW	3	28667951	missense	probably damaging	1.00
Z1176:Tnik	UTSW	3	28604324	missense	probably damaging	1.00
Z1176:Tnik	UTSW	3	28607328	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CGAGTAGAGCACTGTTCTCTCC -3'
(R):5'- GTGAGTGGAGGCTCTTTTAAACAG -3'

Sequencing Primer
(F):5'- TAGCAATGGCCCTGTCATAG -3'
(R):5'- ACAGATGTTTTTCAAAGAGCGTGTG -3'

Posted On

2018-03-15