Incidental Mutation 'R6273:Tnik'
ID 507439
Institutional Source Beutler Lab
Gene Symbol Tnik
Ensembl Gene ENSMUSG00000027692
Gene Name TRAF2 and NCK interacting kinase
Synonyms C530008O15Rik, 4831440I19Rik, 1500031A17Rik, C630040K21Rik
MMRRC Submission 044443-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6273 (G1)
Quality Score 81.0075
Status Validated
Chromosome 3
Chromosomal Location 28317362-28724734 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 28631649 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 383 (H383L)
Ref Sequence ENSEMBL: ENSMUSP00000124726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159236] [ENSMUST00000159308] [ENSMUST00000159680] [ENSMUST00000160307] [ENSMUST00000160518] [ENSMUST00000160934] [ENSMUST00000161964] [ENSMUST00000162485] [ENSMUST00000162777]
AlphaFold P83510
Predicted Effect possibly damaging
Transcript: ENSMUST00000159236
AA Change: H383L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124681
Gene: ENSMUSG00000027692
AA Change: H383L

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 793 812 N/A INTRINSIC
low complexity region 951 958 N/A INTRINSIC
CNH 1005 1303 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159308
AA Change: H383L
SMART Domains Protein: ENSMUSP00000125466
Gene: ENSMUSG00000027692
AA Change: H383L

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 746 765 N/A INTRINSIC
low complexity region 904 911 N/A INTRINSIC
CNH 958 1256 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159680
AA Change: H383L
SMART Domains Protein: ENSMUSP00000124876
Gene: ENSMUSG00000027692
AA Change: H383L

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
CNH 1034 1332 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000160307
AA Change: H383L
SMART Domains Protein: ENSMUSP00000125081
Gene: ENSMUSG00000027692
AA Change: H383L

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 830 849 N/A INTRINSIC
low complexity region 988 995 N/A INTRINSIC
CNH 1042 1340 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000160518
AA Change: H383L
SMART Domains Protein: ENSMUSP00000124011
Gene: ENSMUSG00000027692
AA Change: H383L

DomainStartEndE-ValueType
S_TKc 25 289 5.9e-99 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 801 820 N/A INTRINSIC
low complexity region 959 966 N/A INTRINSIC
CNH 1013 1311 9.3e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160934
SMART Domains Protein: ENSMUSP00000123859
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 25 212 2.2e-37 PFAM
Pfam:Pkinase 25 219 5.9e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161423
Predicted Effect possibly damaging
Transcript: ENSMUST00000161964
AA Change: H383L

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125411
Gene: ENSMUSG00000027692
AA Change: H383L

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 738 757 N/A INTRINSIC
low complexity region 896 903 N/A INTRINSIC
CNH 950 1248 1.92e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162037
Predicted Effect unknown
Transcript: ENSMUST00000162485
AA Change: H383L
SMART Domains Protein: ENSMUSP00000124387
Gene: ENSMUSG00000027692
AA Change: H383L

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 775 794 N/A INTRINSIC
low complexity region 933 940 N/A INTRINSIC
CNH 987 1285 1.92e-117 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162777
AA Change: H383L

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124726
Gene: ENSMUSG00000027692
AA Change: H383L

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 767 786 N/A INTRINSIC
low complexity region 925 932 N/A INTRINSIC
CNH 979 1277 1.92e-117 SMART
Meta Mutation Damage Score 0.1955 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (78/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Germinal center kinases (GCKs), such as TNIK, are characterized by an N-terminal kinase domain and a C-terminal GCK domain that serves a regulatory function (Fu et al., 1999 [PubMed 10521462]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired postsynaptic signaling and cognitive function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 64,055,561 (GRCm39) I99N probably damaging Het
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Ankrd31 A G 13: 96,988,181 (GRCm39) I1065V possibly damaging Het
Aox1 A G 1: 58,378,831 (GRCm39) T1027A probably benign Het
Atm G A 9: 53,399,222 (GRCm39) P1593L probably benign Het
Atp13a5 T G 16: 29,167,555 (GRCm39) I132L probably benign Het
BC035044 A G 6: 128,867,852 (GRCm39) probably benign Het
Cadm3 CT C 1: 173,176,691 (GRCm39) probably benign Homo
Car3 C T 3: 14,936,677 (GRCm39) P247S probably benign Het
Ccdc7a T C 8: 129,513,819 (GRCm39) Y160C probably damaging Het
Cd1d1 A G 3: 86,905,564 (GRCm39) V143A probably benign Het
Cemip2 T A 19: 21,779,369 (GRCm39) V393E probably damaging Het
Cog6 A T 3: 52,903,473 (GRCm39) F142I probably damaging Het
Cracd A T 5: 77,005,568 (GRCm39) D643V unknown Het
Crhr1 T G 11: 104,054,682 (GRCm39) N98K possibly damaging Het
Csf1 A G 3: 107,656,479 (GRCm39) V72A probably damaging Het
Cwc15 T A 9: 14,421,537 (GRCm39) I201K probably benign Het
Dgka T C 10: 128,559,515 (GRCm39) K482R probably benign Het
Dnah7b T C 1: 46,281,476 (GRCm39) S2846P possibly damaging Het
Dst T A 1: 34,314,347 (GRCm39) I4199N probably damaging Het
Dusp7 A G 9: 106,251,095 (GRCm39) T407A possibly damaging Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Fem1a T C 17: 56,564,083 (GRCm39) Y59H possibly damaging Het
Fetub C T 16: 22,751,081 (GRCm39) R143C probably damaging Het
Filip1 A T 9: 79,723,168 (GRCm39) D1150E probably benign Het
Gabra1 A G 11: 42,031,138 (GRCm39) V264A probably damaging Het
Gm4131 T C 14: 62,702,299 (GRCm39) E223G probably damaging Het
Gon4l T C 3: 88,763,156 (GRCm39) V333A probably damaging Het
Gsk3b A G 16: 38,028,408 (GRCm39) T289A probably benign Het
Hmcn2 T C 2: 31,301,846 (GRCm39) S2912P probably damaging Het
Htr7 A T 19: 36,018,969 (GRCm39) probably benign Het
Ibsp A G 5: 104,458,167 (GRCm39) T235A probably benign Het
Ints13 A T 6: 146,467,179 (GRCm39) D116E probably damaging Het
Irag1 G T 7: 110,470,790 (GRCm39) H848N probably benign Het
Kctd19 T C 8: 106,112,117 (GRCm39) N753S probably benign Het
Mdn1 A G 4: 32,715,979 (GRCm39) N2054D probably benign Het
Mink1 A T 11: 70,502,261 (GRCm39) K880* probably null Het
Myo15b T A 11: 115,753,625 (GRCm39) L824Q possibly damaging Het
Napepld T C 5: 21,870,320 (GRCm39) E366G probably benign Het
Obscn T A 11: 58,967,819 (GRCm39) T2662S possibly damaging Het
Or2g7 T G 17: 38,378,686 (GRCm39) L208R probably damaging Het
Or2n1b T A 17: 38,459,833 (GRCm39) M118K possibly damaging Het
Or4k52 T C 2: 111,611,567 (GRCm39) F301L probably benign Het
Or52p1 A G 7: 104,267,102 (GRCm39) D72G probably damaging Het
Or5b12 A G 19: 12,896,764 (GRCm39) V303A probably benign Het
Or6d13 A G 6: 116,518,277 (GRCm39) T288A possibly damaging Het
Pah T C 10: 87,412,077 (GRCm39) probably null Het
Panx3 T G 9: 37,578,725 (GRCm39) I85L probably benign Het
Pate4 T C 9: 35,519,086 (GRCm39) N94D probably benign Het
Pde4d A G 13: 110,086,755 (GRCm39) M610V possibly damaging Het
Pik3c2b T C 1: 132,994,449 (GRCm39) S138P probably benign Het
Pkn1 T C 8: 84,398,899 (GRCm39) N696S probably damaging Het
Plppr2 A G 9: 21,855,801 (GRCm39) E258G probably damaging Het
Plxnd1 A T 6: 115,955,453 (GRCm39) M538K probably damaging Het
Prepl G T 17: 85,390,696 (GRCm39) N87K probably benign Het
Prkag2 C A 5: 25,152,534 (GRCm39) R190L probably damaging Het
Rara A G 11: 98,861,048 (GRCm39) T179A probably benign Het
Rfx7 A G 9: 72,524,279 (GRCm39) K490E possibly damaging Het
Rgsl1 C T 1: 153,703,211 (GRCm39) V147M possibly damaging Het
Rph3a A G 5: 121,083,485 (GRCm39) I595T possibly damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Homo
Slc35e2 C T 4: 155,694,483 (GRCm39) P10L probably benign Het
Slc8a2 T C 7: 15,879,259 (GRCm39) F582L possibly damaging Het
Sprr2e A G 3: 92,260,171 (GRCm39) M1V probably null Het
Steap1 T A 5: 5,790,827 (GRCm39) R40S possibly damaging Het
Tbc1d2 C T 4: 46,629,912 (GRCm39) G252R probably benign Het
Thsd7a A T 6: 12,408,835 (GRCm39) V729E probably damaging Het
Tmprss13 A G 9: 45,256,630 (GRCm39) Y525C probably damaging Het
Vars1 T C 17: 35,232,719 (GRCm39) L881S probably damaging Het
Vmn1r201 A C 13: 22,659,385 (GRCm39) S200R probably damaging Het
Vmn2r130 A T 17: 23,295,759 (GRCm39) H643L probably benign Het
Vmn2r14 A T 5: 109,369,133 (GRCm39) W147R probably benign Het
Vps53 T C 11: 75,992,844 (GRCm39) E367G probably benign Het
Xab2 C T 8: 3,661,822 (GRCm39) G544S probably damaging Het
Ythdf3 T A 3: 16,259,020 (GRCm39) V400E possibly damaging Het
Zfand5 C T 19: 21,257,060 (GRCm39) P147S probably benign Het
Zfp768 A T 7: 126,944,319 (GRCm39) probably null Het
Zswim8 A G 14: 20,763,521 (GRCm39) M423V probably benign Het
Other mutations in Tnik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Tnik APN 3 28,708,367 (GRCm39) missense probably damaging 1.00
IGL00726:Tnik APN 3 28,587,047 (GRCm39) missense probably damaging 1.00
IGL01022:Tnik APN 3 28,679,377 (GRCm39) splice site probably null
IGL01145:Tnik APN 3 28,658,316 (GRCm39) intron probably benign
IGL01664:Tnik APN 3 28,692,628 (GRCm39) missense probably damaging 1.00
IGL01843:Tnik APN 3 28,625,007 (GRCm39) splice site probably null
IGL02378:Tnik APN 3 28,692,608 (GRCm39) nonsense probably null
IGL02448:Tnik APN 3 28,675,226 (GRCm39) missense probably null 0.01
IGL02756:Tnik APN 3 28,596,179 (GRCm39) missense probably damaging 1.00
IGL03332:Tnik APN 3 28,720,304 (GRCm39) missense probably damaging 1.00
delightful UTSW 3 28,658,334 (GRCm39) missense probably damaging 1.00
Hottie UTSW 3 28,317,792 (GRCm39) start codon destroyed probably null 0.93
Knockout UTSW 3 28,715,927 (GRCm39) missense possibly damaging 0.91
Looker UTSW 3 28,715,853 (GRCm39) nonsense probably null
Lovely UTSW 3 28,666,119 (GRCm39) critical splice donor site probably null
Usher UTSW 3 28,618,246 (GRCm39) missense possibly damaging 0.61
R0135:Tnik UTSW 3 28,661,394 (GRCm39) missense possibly damaging 0.67
R0418:Tnik UTSW 3 28,625,029 (GRCm39) nonsense probably null
R0540:Tnik UTSW 3 28,704,308 (GRCm39) missense probably damaging 1.00
R0549:Tnik UTSW 3 28,625,069 (GRCm39) missense possibly damaging 0.87
R0556:Tnik UTSW 3 28,679,367 (GRCm39) missense possibly damaging 0.95
R0586:Tnik UTSW 3 28,631,510 (GRCm39) splice site probably benign
R0607:Tnik UTSW 3 28,704,308 (GRCm39) missense probably damaging 1.00
R0842:Tnik UTSW 3 28,648,235 (GRCm39) missense possibly damaging 0.72
R1068:Tnik UTSW 3 28,587,124 (GRCm39) missense probably damaging 1.00
R1171:Tnik UTSW 3 28,587,089 (GRCm39) missense probably damaging 1.00
R1597:Tnik UTSW 3 28,658,418 (GRCm39) missense probably damaging 1.00
R1638:Tnik UTSW 3 28,719,889 (GRCm39) missense probably damaging 0.99
R1652:Tnik UTSW 3 28,658,442 (GRCm39) missense probably benign 0.22
R1996:Tnik UTSW 3 28,719,829 (GRCm39) missense probably damaging 1.00
R2333:Tnik UTSW 3 28,587,145 (GRCm39) missense probably damaging 1.00
R2426:Tnik UTSW 3 28,700,830 (GRCm39) missense probably damaging 1.00
R2509:Tnik UTSW 3 28,722,064 (GRCm39) missense probably damaging 1.00
R3774:Tnik UTSW 3 28,692,568 (GRCm39) missense probably damaging 0.98
R3775:Tnik UTSW 3 28,692,568 (GRCm39) missense probably damaging 0.98
R4007:Tnik UTSW 3 28,658,430 (GRCm39) missense probably damaging 1.00
R4119:Tnik UTSW 3 28,720,324 (GRCm39) missense probably damaging 1.00
R4209:Tnik UTSW 3 28,413,214 (GRCm39) splice site probably benign
R4441:Tnik UTSW 3 28,618,246 (GRCm39) missense possibly damaging 0.61
R4611:Tnik UTSW 3 28,596,249 (GRCm39) critical splice donor site probably null
R4714:Tnik UTSW 3 28,648,226 (GRCm39) missense possibly damaging 0.53
R4772:Tnik UTSW 3 28,661,359 (GRCm39) missense probably benign 0.09
R4829:Tnik UTSW 3 28,593,690 (GRCm39) intron probably benign
R4839:Tnik UTSW 3 28,650,224 (GRCm39) missense possibly damaging 0.86
R4898:Tnik UTSW 3 28,704,235 (GRCm39) missense probably damaging 1.00
R5029:Tnik UTSW 3 28,719,993 (GRCm39) splice site probably null
R5278:Tnik UTSW 3 28,704,209 (GRCm39) missense probably damaging 1.00
R5307:Tnik UTSW 3 28,596,121 (GRCm39) missense probably damaging 1.00
R5330:Tnik UTSW 3 28,596,167 (GRCm39) missense probably damaging 1.00
R5375:Tnik UTSW 3 28,648,241 (GRCm39) missense probably benign 0.02
R5459:Tnik UTSW 3 28,715,890 (GRCm39) missense probably damaging 1.00
R5708:Tnik UTSW 3 28,666,120 (GRCm39) critical splice donor site probably null
R5749:Tnik UTSW 3 28,648,241 (GRCm39) missense probably benign 0.02
R5751:Tnik UTSW 3 28,648,241 (GRCm39) missense probably benign 0.02
R5780:Tnik UTSW 3 28,648,241 (GRCm39) missense probably benign 0.02
R5837:Tnik UTSW 3 28,722,202 (GRCm39) unclassified probably benign
R5969:Tnik UTSW 3 28,675,097 (GRCm39) missense probably damaging 1.00
R6244:Tnik UTSW 3 28,704,328 (GRCm39) missense probably damaging 1.00
R6457:Tnik UTSW 3 28,593,597 (GRCm39) missense probably damaging 1.00
R6464:Tnik UTSW 3 28,666,119 (GRCm39) critical splice donor site probably null
R6473:Tnik UTSW 3 28,317,792 (GRCm39) start codon destroyed probably null 0.93
R6737:Tnik UTSW 3 28,650,235 (GRCm39) missense possibly damaging 0.72
R7049:Tnik UTSW 3 28,715,853 (GRCm39) nonsense probably null
R7237:Tnik UTSW 3 28,692,568 (GRCm39) missense probably damaging 0.98
R7267:Tnik UTSW 3 28,700,776 (GRCm39) missense probably damaging 0.99
R7445:Tnik UTSW 3 28,718,058 (GRCm39) splice site probably null
R7499:Tnik UTSW 3 28,684,743 (GRCm39) missense possibly damaging 0.47
R7629:Tnik UTSW 3 28,715,877 (GRCm39) missense probably damaging 0.96
R7654:Tnik UTSW 3 28,658,334 (GRCm39) missense probably damaging 1.00
R7886:Tnik UTSW 3 28,720,288 (GRCm39) missense probably damaging 1.00
R8096:Tnik UTSW 3 28,715,927 (GRCm39) missense possibly damaging 0.91
R8210:Tnik UTSW 3 28,658,482 (GRCm39) missense possibly damaging 0.95
R8233:Tnik UTSW 3 28,609,086 (GRCm39) missense unknown
R8386:Tnik UTSW 3 28,317,823 (GRCm39) missense unknown
R8399:Tnik UTSW 3 28,548,159 (GRCm39) missense unknown
R8490:Tnik UTSW 3 28,650,321 (GRCm39) missense probably damaging 0.97
R8539:Tnik UTSW 3 28,596,152 (GRCm39) missense probably damaging 1.00
R8751:Tnik UTSW 3 28,666,057 (GRCm39) missense probably damaging 0.98
R8804:Tnik UTSW 3 28,648,202 (GRCm39) missense unknown
R8966:Tnik UTSW 3 28,587,044 (GRCm39) missense unknown
R8998:Tnik UTSW 3 28,719,920 (GRCm39) missense probably damaging 1.00
R8999:Tnik UTSW 3 28,719,920 (GRCm39) missense probably damaging 1.00
R9016:Tnik UTSW 3 28,692,544 (GRCm39) missense probably damaging 1.00
R9154:Tnik UTSW 3 28,704,235 (GRCm39) missense probably damaging 0.99
R9284:Tnik UTSW 3 28,593,570 (GRCm39) missense unknown
R9290:Tnik UTSW 3 28,675,124 (GRCm39) missense probably benign 0.00
R9411:Tnik UTSW 3 28,684,754 (GRCm39) missense probably damaging 1.00
R9484:Tnik UTSW 3 28,649,093 (GRCm39) missense unknown
X0022:Tnik UTSW 3 28,722,100 (GRCm39) missense probably damaging 1.00
Z1176:Tnik UTSW 3 28,661,477 (GRCm39) missense probably damaging 0.96
Z1176:Tnik UTSW 3 28,658,473 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGTAGAGCACTGTTCTCTCC -3'
(R):5'- GTGAGTGGAGGCTCTTTTAAACAG -3'

Sequencing Primer
(F):5'- TAGCAATGGCCCTGTCATAG -3'
(R):5'- ACAGATGTTTTTCAAAGAGCGTGTG -3'
Posted On 2018-03-15