Mutagenetix > Incidental Mutation

Incidental Mutation 'R6273:Cd1d1'

507441

Institutional Source

Beutler Lab

Gene Symbol

Cd1d1

Ensembl Gene

ENSMUSG00000028076

Gene Name

CD1d1 antigen

Synonyms

CD1.1, Cd1d, Cd1a, Ly-38

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

R6273 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86995834-86999441 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86998257 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 143 (V143A)

Ref Sequence

ENSEMBL: ENSMUSP00000029717 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029717] [ENSMUST00000063869]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000029717
AA Change: V143A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000029717
Gene: ENSMUSG00000028076
AA Change: V143A

Domain	Start	End	E-Value	Type
Pfam:MHC_I_3	1	200	1.3e-95	PFAM
IGc1	221	291	5.35e-22	SMART
transmembrane domain	304	326	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000063869

SMART Domains

Protein: ENSMUSP00000070616
Gene: ENSMUSG00000028076

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
PDB:4MQ7\|A	23	73	2e-15	PDB
IGc1	90	160	5.35e-22	SMART
low complexity region	173	194	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000107620

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132131

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142793

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

98% (78/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a divergent member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene localizes to late endosomes and lysosomes via a tyrosine-based motif in the cytoplasmic tail. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for targeted null mutations lack natural killer T cells, and mutant splenocytes fail to produce interleukin 4 (IL4). [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,218	I99N	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ankrd31	A	G	13: 96,851,673	I1065V	possibly damaging	Het
Aox2	A	G	1: 58,339,672	T1027A	probably benign	Het
Atm	G	A	9: 53,487,922	P1593L	probably benign	Het
Atp13a5	T	G	16: 29,348,737	I132L	probably benign	Het
BC035044	A	G	6: 128,890,889		probably benign	Het
C530008M17Rik	A	T	5: 76,857,721	D643V	unknown	Het
Cadm3	CT	C	1: 173,349,124		probably benign	Homo
Car3	C	T	3: 14,871,617	P247S	probably benign	Het
Ccdc7a	T	C	8: 128,787,338	Y160C	probably damaging	Het
Cog6	A	T	3: 52,996,052	F142I	probably damaging	Het
Crhr1	T	G	11: 104,163,856	N98K	possibly damaging	Het
Csf1	A	G	3: 107,749,163	V72A	probably damaging	Het
Cwc15	T	A	9: 14,510,241	I201K	probably benign	Het
Dgka	T	C	10: 128,723,646	K482R	probably benign	Het
Dnah7b	T	C	1: 46,242,316	S2846P	possibly damaging	Het
Dst	T	A	1: 34,275,266	I4199N	probably damaging	Het
Dusp7	A	G	9: 106,373,896	T407A	possibly damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fem1a	T	C	17: 56,257,083	Y59H	possibly damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Filip1	A	T	9: 79,815,886	D1150E	probably benign	Het
Gabra1	A	G	11: 42,140,311	V264A	probably damaging	Het
Gm4131	T	C	14: 62,464,850	E223G	probably damaging	Het
Gon4l	T	C	3: 88,855,849	V333A	probably damaging	Het
Gsk3b	A	G	16: 38,208,046	T289A	probably benign	Het
Hmcn2	T	C	2: 31,411,834	S2912P	probably damaging	Het
Htr7	A	T	19: 36,041,569		probably benign	Het
Ibsp	A	G	5: 104,310,301	T235A	probably benign	Het
Ints13	A	T	6: 146,565,681	D116E	probably damaging	Het
Kctd19	T	C	8: 105,385,485	N753S	probably benign	Het
Mdn1	A	G	4: 32,715,979	N2054D	probably benign	Het
Mink1	A	T	11: 70,611,435	K880*	probably null	Het
Mrvi1	G	T	7: 110,871,583	H848N	probably benign	Het
Myo15b	T	A	11: 115,862,799	L824Q	possibly damaging	Het
Napepld	T	C	5: 21,665,322	E366G	probably benign	Het
Obscn	T	A	11: 59,076,993	T2662S	possibly damaging	Het
Olfr130	T	G	17: 38,067,795	L208R	probably damaging	Het
Olfr1302	T	C	2: 111,781,222	F301L	probably benign	Het
Olfr133	T	A	17: 38,148,942	M118K	possibly damaging	Het
Olfr1448	A	G	19: 12,919,400	V303A	probably benign	Het
Olfr213	A	G	6: 116,541,316	T288A	possibly damaging	Het
Olfr656	A	G	7: 104,617,895	D72G	probably damaging	Het
Pah	T	C	10: 87,576,215		probably null	Het
Panx3	T	G	9: 37,667,429	I85L	probably benign	Het
Pate4	T	C	9: 35,607,790	N94D	probably benign	Het
Pde4d	A	G	13: 109,950,221	M610V	possibly damaging	Het
Pik3c2b	T	C	1: 133,066,711	S138P	probably benign	Het
Pkn1	T	C	8: 83,672,270	N696S	probably damaging	Het
Plppr2	A	G	9: 21,944,505	E258G	probably damaging	Het
Plxnd1	A	T	6: 115,978,492	M538K	probably damaging	Het
Prepl	G	T	17: 85,083,268	N87K	probably benign	Het
Prkag2	C	A	5: 24,947,536	R190L	probably damaging	Het
Rara	A	G	11: 98,970,222	T179A	probably benign	Het
Rfx7	A	G	9: 72,616,997	K490E	possibly damaging	Het
Rgsl1	C	T	1: 153,827,465	V147M	possibly damaging	Het
Rph3a	A	G	5: 120,945,422	I595T	possibly damaging	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Homo
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Slc8a2	T	C	7: 16,145,334	F582L	possibly damaging	Het
Sprr2e	A	G	3: 92,352,864	M1V	probably null	Het
Steap1	T	A	5: 5,740,827	R40S	possibly damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Thsd7a	A	T	6: 12,408,836	V729E	probably damaging	Het
Tmem2	T	A	19: 21,802,005	V393E	probably damaging	Het
Tmprss13	A	G	9: 45,345,332	Y525C	probably damaging	Het
Tnik	A	T	3: 28,577,500	H383L	possibly damaging	Het
Vars	T	C	17: 35,013,743	L881S	probably damaging	Het
Vmn1r201	A	C	13: 22,475,215	S200R	probably damaging	Het
Vmn2r14	A	T	5: 109,221,267	W147R	probably benign	Het
Vmn2r-ps130	A	T	17: 23,076,785	H643L	probably benign	Het
Vps53	T	C	11: 76,102,018	E367G	probably benign	Het
Xab2	C	T	8: 3,611,822	G544S	probably damaging	Het
Ythdf3	T	A	3: 16,204,856	V400E	possibly damaging	Het
Zfand5	C	T	19: 21,279,696	P147S	probably benign	Het
Zfp768	A	T	7: 127,345,147		probably null	Het
Zswim8	A	G	14: 20,713,453	M423V	probably benign	Het

Other mutations in Cd1d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00588:Cd1d1	APN	3	86998173	missense	probably damaging	0.99
IGL01811:Cd1d1	APN	3	86996588	missense	possibly damaging	0.86
IGL02371:Cd1d1	APN	3	86998881	missense	probably benign	0.40
IGL03001:Cd1d1	APN	3	86998161	missense	probably benign
R0350:Cd1d1	UTSW	3	86997573	missense	probably benign	0.11
R1771:Cd1d1	UTSW	3	86998665	missense	possibly damaging	0.85
R2407:Cd1d1	UTSW	3	86998182	missense	probably damaging	1.00
R3906:Cd1d1	UTSW	3	86998756	missense	probably damaging	1.00
R4540:Cd1d1	UTSW	3	86996705	missense	probably benign	0.21
R4976:Cd1d1	UTSW	3	86998651	missense	probably benign	0.00
R5303:Cd1d1	UTSW	3	86998120	missense	probably benign	0.22
R5786:Cd1d1	UTSW	3	86998788	missense	probably benign	0.17
R6088:Cd1d1	UTSW	3	86998702	missense	probably benign	0.07
R7315:Cd1d1	UTSW	3	86998113	missense	possibly damaging	0.80
R7787:Cd1d1	UTSW	3	86997596	missense	probably damaging	0.98
R8854:Cd1d1	UTSW	3	86998173	missense	probably damaging	0.99
R8957:Cd1d1	UTSW	3	86998833	missense	probably damaging	0.99
R9079:Cd1d1	UTSW	3	86998890	missense	probably benign
R9328:Cd1d1	UTSW	3	86998152	missense	possibly damaging	0.80
R9368:Cd1d1	UTSW	3	86998632	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGTGAAAATAGCCAGCTGACC -3'
(R):5'- ATTTTCCTCAACTGGCACTTAACG -3'

Sequencing Primer
(F):5'- GAAAATAGCCAGCTGACCTTGCTTC -3'
(R):5'- CAACTGGCACTTAACGATAATCTTC -3'

Posted On

2018-03-15