Mutagenetix > Incidental Mutation

Incidental Mutation 'R6273:Gon4l'

507442

Institutional Source

Beutler Lab

Gene Symbol

Gon4l

Ensembl Gene

ENSMUSG00000054199

Gene Name

gon-4-like (C.elegans)

Synonyms

2610100B20Rik, 1500041I23Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.862) question?

Stock #

R6273 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

88835231-88910103 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 88855849 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 333 (V333A)

Ref Sequence

ENSEMBL: ENSMUSP00000103122 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081695] [ENSMUST00000090942] [ENSMUST00000107498]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000081695
AA Change: V333A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000080397
Gene: ENSMUSG00000054199
AA Change: V333A

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
low complexity region	150	163	N/A	INTRINSIC
low complexity region	240	256	N/A	INTRINSIC
low complexity region	348	377	N/A	INTRINSIC
low complexity region	432	439	N/A	INTRINSIC
low complexity region	527	542	N/A	INTRINSIC
low complexity region	683	696	N/A	INTRINSIC
Blast:SANT	813	865	1e-23	BLAST
low complexity region	961	975	N/A	INTRINSIC
low complexity region	1311	1329	N/A	INTRINSIC
low complexity region	1418	1434	N/A	INTRINSIC
low complexity region	1452	1497	N/A	INTRINSIC
low complexity region	1507	1541	N/A	INTRINSIC
Pfam:PAH	1652	1700	8.8e-9	PFAM
low complexity region	1800	1811	N/A	INTRINSIC
coiled coil region	1919	1943	N/A	INTRINSIC
low complexity region	2085	2094	N/A	INTRINSIC
SANT	2153	2204	2.2e-1	SMART
low complexity region	2207	2222	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000090942
AA Change: V334A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000088461
Gene: ENSMUSG00000054199
AA Change: V334A

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
low complexity region	150	163	N/A	INTRINSIC
low complexity region	241	257	N/A	INTRINSIC
low complexity region	349	378	N/A	INTRINSIC
low complexity region	433	440	N/A	INTRINSIC
low complexity region	528	543	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
Blast:SANT	814	866	2e-23	BLAST
low complexity region	962	976	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
low complexity region	1419	1435	N/A	INTRINSIC
low complexity region	1453	1498	N/A	INTRINSIC
low complexity region	1508	1542	N/A	INTRINSIC
Pfam:PAH	1654	1700	2.1e-8	PFAM
low complexity region	1801	1812	N/A	INTRINSIC
coiled coil region	1920	1944	N/A	INTRINSIC
low complexity region	2086	2095	N/A	INTRINSIC
SANT	2154	2205	2.2e-1	SMART
low complexity region	2208	2223	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107498
AA Change: V333A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103122
Gene: ENSMUSG00000054199
AA Change: V333A

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
low complexity region	150	163	N/A	INTRINSIC
low complexity region	240	256	N/A	INTRINSIC
low complexity region	348	377	N/A	INTRINSIC
low complexity region	432	439	N/A	INTRINSIC
low complexity region	527	542	N/A	INTRINSIC
low complexity region	683	696	N/A	INTRINSIC
Blast:SANT	813	865	1e-23	BLAST
low complexity region	961	975	N/A	INTRINSIC
low complexity region	1311	1329	N/A	INTRINSIC
low complexity region	1418	1434	N/A	INTRINSIC
low complexity region	1452	1497	N/A	INTRINSIC
low complexity region	1507	1541	N/A	INTRINSIC
Pfam:PAH	1652	1700	8.8e-9	PFAM
low complexity region	1800	1811	N/A	INTRINSIC
coiled coil region	1919	1943	N/A	INTRINSIC
low complexity region	2085	2094	N/A	INTRINSIC
SANT	2153	2204	2.2e-1	SMART
low complexity region	2207	2222	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198251

Predicted Effect

unknown
Transcript: ENSMUST00000212694
AA Change: V24A

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

98% (78/80)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit arrested B cell development at the early pro-B cell stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,218	I99N	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ankrd31	A	G	13: 96,851,673	I1065V	possibly damaging	Het
Aox2	A	G	1: 58,339,672	T1027A	probably benign	Het
Atm	G	A	9: 53,487,922	P1593L	probably benign	Het
Atp13a5	T	G	16: 29,348,737	I132L	probably benign	Het
BC035044	A	G	6: 128,890,889		probably benign	Het
C530008M17Rik	A	T	5: 76,857,721	D643V	unknown	Het
Cadm3	CT	C	1: 173,349,124		probably benign	Homo
Car3	C	T	3: 14,871,617	P247S	probably benign	Het
Ccdc7a	T	C	8: 128,787,338	Y160C	probably damaging	Het
Cd1d1	A	G	3: 86,998,257	V143A	probably benign	Het
Cog6	A	T	3: 52,996,052	F142I	probably damaging	Het
Crhr1	T	G	11: 104,163,856	N98K	possibly damaging	Het
Csf1	A	G	3: 107,749,163	V72A	probably damaging	Het
Cwc15	T	A	9: 14,510,241	I201K	probably benign	Het
Dgka	T	C	10: 128,723,646	K482R	probably benign	Het
Dnah7b	T	C	1: 46,242,316	S2846P	possibly damaging	Het
Dst	T	A	1: 34,275,266	I4199N	probably damaging	Het
Dusp7	A	G	9: 106,373,896	T407A	possibly damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fem1a	T	C	17: 56,257,083	Y59H	possibly damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Filip1	A	T	9: 79,815,886	D1150E	probably benign	Het
Gabra1	A	G	11: 42,140,311	V264A	probably damaging	Het
Gm4131	T	C	14: 62,464,850	E223G	probably damaging	Het
Gsk3b	A	G	16: 38,208,046	T289A	probably benign	Het
Hmcn2	T	C	2: 31,411,834	S2912P	probably damaging	Het
Htr7	A	T	19: 36,041,569		probably benign	Het
Ibsp	A	G	5: 104,310,301	T235A	probably benign	Het
Ints13	A	T	6: 146,565,681	D116E	probably damaging	Het
Kctd19	T	C	8: 105,385,485	N753S	probably benign	Het
Mdn1	A	G	4: 32,715,979	N2054D	probably benign	Het
Mink1	A	T	11: 70,611,435	K880*	probably null	Het
Mrvi1	G	T	7: 110,871,583	H848N	probably benign	Het
Myo15b	T	A	11: 115,862,799	L824Q	possibly damaging	Het
Napepld	T	C	5: 21,665,322	E366G	probably benign	Het
Obscn	T	A	11: 59,076,993	T2662S	possibly damaging	Het
Olfr130	T	G	17: 38,067,795	L208R	probably damaging	Het
Olfr1302	T	C	2: 111,781,222	F301L	probably benign	Het
Olfr133	T	A	17: 38,148,942	M118K	possibly damaging	Het
Olfr1448	A	G	19: 12,919,400	V303A	probably benign	Het
Olfr213	A	G	6: 116,541,316	T288A	possibly damaging	Het
Olfr656	A	G	7: 104,617,895	D72G	probably damaging	Het
Pah	T	C	10: 87,576,215		probably null	Het
Panx3	T	G	9: 37,667,429	I85L	probably benign	Het
Pate4	T	C	9: 35,607,790	N94D	probably benign	Het
Pde4d	A	G	13: 109,950,221	M610V	possibly damaging	Het
Pik3c2b	T	C	1: 133,066,711	S138P	probably benign	Het
Pkn1	T	C	8: 83,672,270	N696S	probably damaging	Het
Plppr2	A	G	9: 21,944,505	E258G	probably damaging	Het
Plxnd1	A	T	6: 115,978,492	M538K	probably damaging	Het
Prepl	G	T	17: 85,083,268	N87K	probably benign	Het
Prkag2	C	A	5: 24,947,536	R190L	probably damaging	Het
Rara	A	G	11: 98,970,222	T179A	probably benign	Het
Rfx7	A	G	9: 72,616,997	K490E	possibly damaging	Het
Rgsl1	C	T	1: 153,827,465	V147M	possibly damaging	Het
Rph3a	A	G	5: 120,945,422	I595T	possibly damaging	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Homo
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Slc8a2	T	C	7: 16,145,334	F582L	possibly damaging	Het
Sprr2e	A	G	3: 92,352,864	M1V	probably null	Het
Steap1	T	A	5: 5,740,827	R40S	possibly damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Thsd7a	A	T	6: 12,408,836	V729E	probably damaging	Het
Tmem2	T	A	19: 21,802,005	V393E	probably damaging	Het
Tmprss13	A	G	9: 45,345,332	Y525C	probably damaging	Het
Tnik	A	T	3: 28,577,500	H383L	possibly damaging	Het
Vars	T	C	17: 35,013,743	L881S	probably damaging	Het
Vmn1r201	A	C	13: 22,475,215	S200R	probably damaging	Het
Vmn2r14	A	T	5: 109,221,267	W147R	probably benign	Het
Vmn2r-ps130	A	T	17: 23,076,785	H643L	probably benign	Het
Vps53	T	C	11: 76,102,018	E367G	probably benign	Het
Xab2	C	T	8: 3,611,822	G544S	probably damaging	Het
Ythdf3	T	A	3: 16,204,856	V400E	possibly damaging	Het
Zfand5	C	T	19: 21,279,696	P147S	probably benign	Het
Zfp768	A	T	7: 127,345,147		probably null	Het
Zswim8	A	G	14: 20,713,453	M423V	probably benign	Het

Other mutations in Gon4l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00870:Gon4l	APN	3	88857185	missense	probably damaging	1.00
IGL02002:Gon4l	APN	3	88895336	missense	possibly damaging	0.46
IGL02065:Gon4l	APN	3	88857210	missense	probably null	1.00
IGL02283:Gon4l	APN	3	88895364	missense	probably damaging	0.99
IGL02669:Gon4l	APN	3	88895499	missense	probably damaging	1.00
IGL03222:Gon4l	APN	3	88895643	missense	possibly damaging	0.56
IGL03385:Gon4l	APN	3	88907543	missense	probably benign	0.10
PIT4581001:Gon4l	UTSW	3	88895514	missense	probably damaging	1.00
R0020:Gon4l	UTSW	3	88858937	missense	probably damaging	1.00
R0115:Gon4l	UTSW	3	88895682	missense	probably damaging	1.00
R0173:Gon4l	UTSW	3	88858403	missense	probably damaging	1.00
R0270:Gon4l	UTSW	3	88858400	missense	probably damaging	1.00
R0961:Gon4l	UTSW	3	88898096	splice site	probably benign
R1017:Gon4l	UTSW	3	88858496	missense	probably benign	0.15
R1163:Gon4l	UTSW	3	88892535	missense	probably damaging	1.00
R1729:Gon4l	UTSW	3	88903098	missense	probably damaging	1.00
R1764:Gon4l	UTSW	3	88892599	missense	probably damaging	1.00
R1861:Gon4l	UTSW	3	88895487	missense	probably damaging	1.00
R2141:Gon4l	UTSW	3	88887595	missense	possibly damaging	0.66
R2347:Gon4l	UTSW	3	88863517	missense	probably damaging	1.00
R2402:Gon4l	UTSW	3	88859043	missense	probably damaging	1.00
R2842:Gon4l	UTSW	3	88895487	missense	probably damaging	1.00
R4375:Gon4l	UTSW	3	88907387	missense	probably benign	0.00
R4376:Gon4l	UTSW	3	88907387	missense	probably benign	0.00
R4377:Gon4l	UTSW	3	88907387	missense	probably benign	0.00
R4569:Gon4l	UTSW	3	88910090	intron	probably benign
R4650:Gon4l	UTSW	3	88863552	missense	possibly damaging	0.94
R4859:Gon4l	UTSW	3	88895348	missense	probably benign	0.00
R4901:Gon4l	UTSW	3	88908151	missense	possibly damaging	0.50
R4998:Gon4l	UTSW	3	88899998	missense	probably damaging	1.00
R5059:Gon4l	UTSW	3	88900012	missense	probably benign	0.00
R5217:Gon4l	UTSW	3	88887575	missense	probably damaging	1.00
R5269:Gon4l	UTSW	3	88895528	missense	probably benign
R5279:Gon4l	UTSW	3	88887637	missense	probably benign
R5283:Gon4l	UTSW	3	88887590	missense	probably damaging	1.00
R5386:Gon4l	UTSW	3	88858496	missense	probably benign	0.15
R5433:Gon4l	UTSW	3	88896225	missense	possibly damaging	0.93
R5583:Gon4l	UTSW	3	88899971	missense	probably damaging	1.00
R5695:Gon4l	UTSW	3	88896216	frame shift	probably null
R5921:Gon4l	UTSW	3	88909947	intron	probably benign
R6003:Gon4l	UTSW	3	88896093	missense	probably damaging	0.99
R6063:Gon4l	UTSW	3	88899999	missense	probably damaging	1.00
R6217:Gon4l	UTSW	3	88892661	missense	possibly damaging	0.62
R6280:Gon4l	UTSW	3	88890888	missense	probably damaging	1.00
R6790:Gon4l	UTSW	3	88858998	missense	probably damaging	1.00
R6829:Gon4l	UTSW	3	88880106	missense	possibly damaging	0.96
R6891:Gon4l	UTSW	3	88858866	splice site	probably null
R7128:Gon4l	UTSW	3	88895692	missense	possibly damaging	0.94
R7315:Gon4l	UTSW	3	88895179	missense	probably benign	0.00
R7355:Gon4l	UTSW	3	88863520	missense	probably damaging	1.00
R7426:Gon4l	UTSW	3	88907522	missense	probably benign
R7635:Gon4l	UTSW	3	88895106	missense	probably benign	0.03
R7643:Gon4l	UTSW	3	88902807	missense	probably damaging	1.00
R7715:Gon4l	UTSW	3	88908006	missense	probably benign
R7773:Gon4l	UTSW	3	88895795	missense	probably benign	0.00
R8090:Gon4l	UTSW	3	88892624	missense	probably damaging	1.00
R8224:Gon4l	UTSW	3	88895142	missense	probably damaging	1.00
R8260:Gon4l	UTSW	3	88892630	missense	probably damaging	0.98
R8434:Gon4l	UTSW	3	88854779	missense	probably damaging	1.00
R8732:Gon4l	UTSW	3	88899984	missense	possibly damaging	0.95
R8812:Gon4l	UTSW	3	88895007	missense	possibly damaging	0.86
R9132:Gon4l	UTSW	3	88908177	missense	probably benign	0.29
R9161:Gon4l	UTSW	3	88901648	missense	probably damaging	1.00
R9187:Gon4l	UTSW	3	88879311	missense	probably benign	0.10
R9212:Gon4l	UTSW	3	88896423	missense	probably benign	0.01
R9338:Gon4l	UTSW	3	88901712	missense	probably benign	0.00
R9387:Gon4l	UTSW	3	88894953	missense	probably benign	0.00
R9416:Gon4l	UTSW	3	88896231	missense	probably benign	0.00
R9607:Gon4l	UTSW	3	88858444	missense	probably damaging	0.99
Z1177:Gon4l	UTSW	3	88859036	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTAACGTGGGATTTCCTC -3'
(R):5'- TAGGCAAGATCACACTGAGC -3'

Sequencing Primer
(F):5'- TGGCTATGATGAAGGCAGCCATC -3'
(R):5'- TGAGCTAAGAGTCCCAGCC -3'

Posted On

2018-03-15