Incidental Mutation 'R6273:Vmn2r14'
ID 507453
Institutional Source Beutler Lab
Gene Symbol Vmn2r14
Ensembl Gene ENSMUSG00000091059
Gene Name vomeronasal 2, receptor 14
Synonyms EG231591
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.420) question?
Stock # R6273 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 109215502-109224622 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 109221267 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 147 (W147R)
Ref Sequence ENSEMBL: ENSMUSP00000128015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170341]
AlphaFold E9Q759
Predicted Effect probably benign
Transcript: ENSMUST00000170341
AA Change: W147R

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128015
Gene: ENSMUSG00000091059
AA Change: W147R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 466 8.3e-31 PFAM
Pfam:NCD3G 507 561 1.1e-17 PFAM
Pfam:7tm_3 594 829 1.2e-55 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (78/80)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,218 I99N probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ankrd31 A G 13: 96,851,673 I1065V possibly damaging Het
Aox2 A G 1: 58,339,672 T1027A probably benign Het
Atm G A 9: 53,487,922 P1593L probably benign Het
Atp13a5 T G 16: 29,348,737 I132L probably benign Het
BC035044 A G 6: 128,890,889 probably benign Het
C530008M17Rik A T 5: 76,857,721 D643V unknown Het
Cadm3 CT C 1: 173,349,124 probably benign Homo
Car3 C T 3: 14,871,617 P247S probably benign Het
Ccdc7a T C 8: 128,787,338 Y160C probably damaging Het
Cd1d1 A G 3: 86,998,257 V143A probably benign Het
Cog6 A T 3: 52,996,052 F142I probably damaging Het
Crhr1 T G 11: 104,163,856 N98K possibly damaging Het
Csf1 A G 3: 107,749,163 V72A probably damaging Het
Cwc15 T A 9: 14,510,241 I201K probably benign Het
Dgka T C 10: 128,723,646 K482R probably benign Het
Dnah7b T C 1: 46,242,316 S2846P possibly damaging Het
Dst T A 1: 34,275,266 I4199N probably damaging Het
Dusp7 A G 9: 106,373,896 T407A possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fem1a T C 17: 56,257,083 Y59H possibly damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Filip1 A T 9: 79,815,886 D1150E probably benign Het
Gabra1 A G 11: 42,140,311 V264A probably damaging Het
Gm4131 T C 14: 62,464,850 E223G probably damaging Het
Gon4l T C 3: 88,855,849 V333A probably damaging Het
Gsk3b A G 16: 38,208,046 T289A probably benign Het
Hmcn2 T C 2: 31,411,834 S2912P probably damaging Het
Htr7 A T 19: 36,041,569 probably benign Het
Ibsp A G 5: 104,310,301 T235A probably benign Het
Ints13 A T 6: 146,565,681 D116E probably damaging Het
Kctd19 T C 8: 105,385,485 N753S probably benign Het
Mdn1 A G 4: 32,715,979 N2054D probably benign Het
Mink1 A T 11: 70,611,435 K880* probably null Het
Mrvi1 G T 7: 110,871,583 H848N probably benign Het
Myo15b T A 11: 115,862,799 L824Q possibly damaging Het
Napepld T C 5: 21,665,322 E366G probably benign Het
Obscn T A 11: 59,076,993 T2662S possibly damaging Het
Olfr130 T G 17: 38,067,795 L208R probably damaging Het
Olfr1302 T C 2: 111,781,222 F301L probably benign Het
Olfr133 T A 17: 38,148,942 M118K possibly damaging Het
Olfr1448 A G 19: 12,919,400 V303A probably benign Het
Olfr213 A G 6: 116,541,316 T288A possibly damaging Het
Olfr656 A G 7: 104,617,895 D72G probably damaging Het
Pah T C 10: 87,576,215 probably null Het
Panx3 T G 9: 37,667,429 I85L probably benign Het
Pate4 T C 9: 35,607,790 N94D probably benign Het
Pde4d A G 13: 109,950,221 M610V possibly damaging Het
Pik3c2b T C 1: 133,066,711 S138P probably benign Het
Pkn1 T C 8: 83,672,270 N696S probably damaging Het
Plppr2 A G 9: 21,944,505 E258G probably damaging Het
Plxnd1 A T 6: 115,978,492 M538K probably damaging Het
Prepl G T 17: 85,083,268 N87K probably benign Het
Prkag2 C A 5: 24,947,536 R190L probably damaging Het
Rara A G 11: 98,970,222 T179A probably benign Het
Rfx7 A G 9: 72,616,997 K490E possibly damaging Het
Rgsl1 C T 1: 153,827,465 V147M possibly damaging Het
Rph3a A G 5: 120,945,422 I595T possibly damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc8a2 T C 7: 16,145,334 F582L possibly damaging Het
Sprr2e A G 3: 92,352,864 M1V probably null Het
Steap1 T A 5: 5,740,827 R40S possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thsd7a A T 6: 12,408,836 V729E probably damaging Het
Tmem2 T A 19: 21,802,005 V393E probably damaging Het
Tmprss13 A G 9: 45,345,332 Y525C probably damaging Het
Tnik A T 3: 28,577,500 H383L possibly damaging Het
Vars T C 17: 35,013,743 L881S probably damaging Het
Vmn1r201 A C 13: 22,475,215 S200R probably damaging Het
Vmn2r-ps130 A T 17: 23,076,785 H643L probably benign Het
Vps53 T C 11: 76,102,018 E367G probably benign Het
Xab2 C T 8: 3,611,822 G544S probably damaging Het
Ythdf3 T A 3: 16,204,856 V400E possibly damaging Het
Zfand5 C T 19: 21,279,696 P147S probably benign Het
Zfp768 A T 7: 127,345,147 probably null Het
Zswim8 A G 14: 20,713,453 M423V probably benign Het
Other mutations in Vmn2r14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Vmn2r14 APN 5 109216314 nonsense probably null
IGL01504:Vmn2r14 APN 5 109221419 missense probably benign 0.01
IGL01828:Vmn2r14 APN 5 109224577 missense possibly damaging 0.71
IGL02093:Vmn2r14 APN 5 109220409 missense possibly damaging 0.94
IGL02103:Vmn2r14 APN 5 109224483 missense probably damaging 0.96
IGL02123:Vmn2r14 APN 5 109220067 missense probably damaging 1.00
IGL02145:Vmn2r14 APN 5 109220588 nonsense probably null
IGL02676:Vmn2r14 APN 5 109220016 missense probably benign 0.03
IGL02720:Vmn2r14 APN 5 109221439 missense probably damaging 1.00
IGL02877:Vmn2r14 APN 5 109220188 missense probably damaging 0.99
IGL02974:Vmn2r14 APN 5 109221426 missense possibly damaging 0.55
IGL03151:Vmn2r14 APN 5 109216394 missense probably damaging 1.00
IGL03297:Vmn2r14 APN 5 109216107 missense probably damaging 1.00
IGL03386:Vmn2r14 APN 5 109220484 missense possibly damaging 0.90
IGL03394:Vmn2r14 APN 5 109219836 missense probably null 0.83
ANU74:Vmn2r14 UTSW 5 109219044 missense probably benign 0.00
R0316:Vmn2r14 UTSW 5 109218896 missense probably benign 0.07
R0755:Vmn2r14 UTSW 5 109216360 missense possibly damaging 0.81
R1219:Vmn2r14 UTSW 5 109224574 missense probably benign 0.17
R1321:Vmn2r14 UTSW 5 109216251 missense probably benign 0.08
R1465:Vmn2r14 UTSW 5 109220329 missense possibly damaging 0.47
R1465:Vmn2r14 UTSW 5 109220329 missense possibly damaging 0.47
R1509:Vmn2r14 UTSW 5 109215996 missense probably benign 0.00
R1551:Vmn2r14 UTSW 5 109221417 missense probably damaging 1.00
R1628:Vmn2r14 UTSW 5 109219972 missense probably benign 0.00
R1668:Vmn2r14 UTSW 5 109219047 nonsense probably null
R2013:Vmn2r14 UTSW 5 109221243 missense probably benign 0.00
R2201:Vmn2r14 UTSW 5 109218832 splice site probably null
R2417:Vmn2r14 UTSW 5 109224463 missense probably benign 0.00
R3029:Vmn2r14 UTSW 5 109215910 missense probably damaging 1.00
R3120:Vmn2r14 UTSW 5 109224565 missense probably null 0.00
R3729:Vmn2r14 UTSW 5 109216229 missense probably damaging 1.00
R3762:Vmn2r14 UTSW 5 109220167 missense probably benign 0.02
R3943:Vmn2r14 UTSW 5 109216064 missense probably damaging 1.00
R3944:Vmn2r14 UTSW 5 109216064 missense probably damaging 1.00
R4222:Vmn2r14 UTSW 5 109216283 missense probably benign 0.00
R4224:Vmn2r14 UTSW 5 109216283 missense probably benign 0.00
R4239:Vmn2r14 UTSW 5 109216411 critical splice acceptor site probably null
R4240:Vmn2r14 UTSW 5 109216411 critical splice acceptor site probably null
R4782:Vmn2r14 UTSW 5 109221504 missense probably benign 0.01
R4832:Vmn2r14 UTSW 5 109216110 missense probably damaging 1.00
R4884:Vmn2r14 UTSW 5 109221518 splice site probably null
R4896:Vmn2r14 UTSW 5 109220380 missense probably benign 0.19
R5004:Vmn2r14 UTSW 5 109220380 missense probably benign 0.19
R5117:Vmn2r14 UTSW 5 109216095 missense probably benign 0.16
R5285:Vmn2r14 UTSW 5 109217576 missense probably damaging 0.98
R5413:Vmn2r14 UTSW 5 109221288 missense probably benign 0.29
R5569:Vmn2r14 UTSW 5 109220395 missense probably benign 0.44
R5701:Vmn2r14 UTSW 5 109219950 missense probably damaging 1.00
R5726:Vmn2r14 UTSW 5 109217620 missense possibly damaging 0.95
R5763:Vmn2r14 UTSW 5 109215858 missense possibly damaging 0.49
R5872:Vmn2r14 UTSW 5 109221356 missense probably benign
R5985:Vmn2r14 UTSW 5 109220216 missense possibly damaging 0.89
R6268:Vmn2r14 UTSW 5 109221417 missense possibly damaging 0.87
R6409:Vmn2r14 UTSW 5 109216230 missense probably benign 0.09
R6944:Vmn2r14 UTSW 5 109216059 missense probably benign 0.22
R6944:Vmn2r14 UTSW 5 109216274 missense probably benign 0.06
R7608:Vmn2r14 UTSW 5 109221410 missense probably benign 0.03
R7740:Vmn2r14 UTSW 5 109220458 missense probably benign 0.41
R7768:Vmn2r14 UTSW 5 109220220 missense probably benign 0.01
R7804:Vmn2r14 UTSW 5 109220458 missense probably benign 0.41
R7872:Vmn2r14 UTSW 5 109221353 missense probably benign 0.02
R7993:Vmn2r14 UTSW 5 109215996 missense probably benign 0.00
R8006:Vmn2r14 UTSW 5 109220458 missense probably benign 0.41
R8007:Vmn2r14 UTSW 5 109220458 missense probably benign 0.41
R8187:Vmn2r14 UTSW 5 109220554 missense probably benign 0.03
R8369:Vmn2r14 UTSW 5 109221476 missense probably damaging 1.00
R8463:Vmn2r14 UTSW 5 109221474 missense probably benign 0.30
R8968:Vmn2r14 UTSW 5 109217667 missense probably benign 0.01
R9008:Vmn2r14 UTSW 5 109220027 missense probably benign 0.00
R9030:Vmn2r14 UTSW 5 109220188 missense probably damaging 0.99
R9039:Vmn2r14 UTSW 5 109220036 nonsense probably null
R9150:Vmn2r14 UTSW 5 109219917 missense probably damaging 1.00
R9164:Vmn2r14 UTSW 5 109216221 missense probably damaging 1.00
R9216:Vmn2r14 UTSW 5 109221246 missense probably benign 0.01
R9225:Vmn2r14 UTSW 5 109221422 missense probably damaging 1.00
R9245:Vmn2r14 UTSW 5 109220310 missense possibly damaging 0.89
R9342:Vmn2r14 UTSW 5 109220562 missense probably damaging 1.00
R9472:Vmn2r14 UTSW 5 109220096 missense probably benign 0.00
R9678:Vmn2r14 UTSW 5 109216175 missense probably damaging 1.00
R9774:Vmn2r14 UTSW 5 109221260 missense probably benign 0.07
Z1177:Vmn2r14 UTSW 5 109219875 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TCTTGTAGGCACATGTAAATGGAC -3'
(R):5'- GTAATCTAGTTCAAGGTTGGCATTC -3'

Sequencing Primer
(F):5'- GAGTTCAATTCCCAGTAACCATGTGG -3'
(R):5'- CCAGCAAGAAGACATGAGTTTTTCC -3'
Posted On 2018-03-15