Mutagenetix > Incidental Mutation

Incidental Mutation 'R6273:Thsd7a'

507455

Institutional Source

Beutler Lab

Gene Symbol

Thsd7a

Ensembl Gene

ENSMUSG00000032625

Gene Name

thrombospondin, type I, domain containing 7A

Synonyms

LOC330267

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6273 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12311610-12749410 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 12408836 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 729 (V729E)

Ref Sequence

ENSEMBL: ENSMUSP00000131662 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119581] [ENSMUST00000172356]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000119581
AA Change: V729E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000113681
Gene: ENSMUSG00000032625
AA Change: V729E

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1082	9.09e-8	SMART
TSP1	1085	1150	5.82e-1	SMART
TSP1	1155	1207	4.24e-2	SMART
TSP1	1210	1271	1e0	SMART
TSP1	1276	1328	3.55e-10	SMART
TSP1	1329	1399	7.5e-2	SMART
TSP1	1404	1462	1.55e-1	SMART
transmembrane domain	1594	1616	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122369

SMART Domains

Protein: ENSMUSP00000112503
Gene: ENSMUSG00000032625

Domain	Start	End	E-Value	Type
TSP1	43	100	6.24e-6	SMART
TSP1	178	228	7.31e-2	SMART
Blast:TSP1	232	302	4e-26	BLAST
TSP1	307	362	9.09e-8	SMART
TSP1	365	430	5.82e-1	SMART
TSP1	435	487	4.24e-2	SMART
TSP1	490	551	1e0	SMART
TSP1	556	608	3.55e-10	SMART
TSP1	609	679	7.5e-2	SMART
TSP1	684	742	1.55e-1	SMART
transmembrane domain	874	896	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000172356
AA Change: V729E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000131662
Gene: ENSMUSG00000032625
AA Change: V729E

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1084	1.95e-7	SMART
TSP1	1087	1152	5.82e-1	SMART
TSP1	1157	1209	4.24e-2	SMART
TSP1	1212	1273	1e0	SMART
TSP1	1278	1330	3.55e-10	SMART
TSP1	1331	1401	7.5e-2	SMART
TSP1	1406	1464	1.55e-1	SMART
transmembrane domain	1596	1618	N/A	INTRINSIC

Meta Mutation Damage Score

0.1319

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

98% (78/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found almost exclusively in endothelial cells from placenta and umbilical cord. The encoded protein appears to interact with alpha(V)beta(3) integrin and paxillin to inhibit endothelial cell migration and tube formation. This protein may be involved in cytoskeletal organization. Variations in this gene may be associated with low bone mineral density in osteoporosis. [provided by RefSeq, Aug 2010]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,218	I99N	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ankrd31	A	G	13: 96,851,673	I1065V	possibly damaging	Het
Aox2	A	G	1: 58,339,672	T1027A	probably benign	Het
Atm	G	A	9: 53,487,922	P1593L	probably benign	Het
Atp13a5	T	G	16: 29,348,737	I132L	probably benign	Het
BC035044	A	G	6: 128,890,889		probably benign	Het
C530008M17Rik	A	T	5: 76,857,721	D643V	unknown	Het
Cadm3	CT	C	1: 173,349,124		probably benign	Homo
Car3	C	T	3: 14,871,617	P247S	probably benign	Het
Ccdc7a	T	C	8: 128,787,338	Y160C	probably damaging	Het
Cd1d1	A	G	3: 86,998,257	V143A	probably benign	Het
Cog6	A	T	3: 52,996,052	F142I	probably damaging	Het
Crhr1	T	G	11: 104,163,856	N98K	possibly damaging	Het
Csf1	A	G	3: 107,749,163	V72A	probably damaging	Het
Cwc15	T	A	9: 14,510,241	I201K	probably benign	Het
Dgka	T	C	10: 128,723,646	K482R	probably benign	Het
Dnah7b	T	C	1: 46,242,316	S2846P	possibly damaging	Het
Dst	T	A	1: 34,275,266	I4199N	probably damaging	Het
Dusp7	A	G	9: 106,373,896	T407A	possibly damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fem1a	T	C	17: 56,257,083	Y59H	possibly damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Filip1	A	T	9: 79,815,886	D1150E	probably benign	Het
Gabra1	A	G	11: 42,140,311	V264A	probably damaging	Het
Gm4131	T	C	14: 62,464,850	E223G	probably damaging	Het
Gon4l	T	C	3: 88,855,849	V333A	probably damaging	Het
Gsk3b	A	G	16: 38,208,046	T289A	probably benign	Het
Hmcn2	T	C	2: 31,411,834	S2912P	probably damaging	Het
Htr7	A	T	19: 36,041,569		probably benign	Het
Ibsp	A	G	5: 104,310,301	T235A	probably benign	Het
Ints13	A	T	6: 146,565,681	D116E	probably damaging	Het
Kctd19	T	C	8: 105,385,485	N753S	probably benign	Het
Mdn1	A	G	4: 32,715,979	N2054D	probably benign	Het
Mink1	A	T	11: 70,611,435	K880*	probably null	Het
Mrvi1	G	T	7: 110,871,583	H848N	probably benign	Het
Myo15b	T	A	11: 115,862,799	L824Q	possibly damaging	Het
Napepld	T	C	5: 21,665,322	E366G	probably benign	Het
Obscn	T	A	11: 59,076,993	T2662S	possibly damaging	Het
Olfr130	T	G	17: 38,067,795	L208R	probably damaging	Het
Olfr1302	T	C	2: 111,781,222	F301L	probably benign	Het
Olfr133	T	A	17: 38,148,942	M118K	possibly damaging	Het
Olfr1448	A	G	19: 12,919,400	V303A	probably benign	Het
Olfr213	A	G	6: 116,541,316	T288A	possibly damaging	Het
Olfr656	A	G	7: 104,617,895	D72G	probably damaging	Het
Pah	T	C	10: 87,576,215		probably null	Het
Panx3	T	G	9: 37,667,429	I85L	probably benign	Het
Pate4	T	C	9: 35,607,790	N94D	probably benign	Het
Pde4d	A	G	13: 109,950,221	M610V	possibly damaging	Het
Pik3c2b	T	C	1: 133,066,711	S138P	probably benign	Het
Pkn1	T	C	8: 83,672,270	N696S	probably damaging	Het
Plppr2	A	G	9: 21,944,505	E258G	probably damaging	Het
Plxnd1	A	T	6: 115,978,492	M538K	probably damaging	Het
Prepl	G	T	17: 85,083,268	N87K	probably benign	Het
Prkag2	C	A	5: 24,947,536	R190L	probably damaging	Het
Rara	A	G	11: 98,970,222	T179A	probably benign	Het
Rfx7	A	G	9: 72,616,997	K490E	possibly damaging	Het
Rgsl1	C	T	1: 153,827,465	V147M	possibly damaging	Het
Rph3a	A	G	5: 120,945,422	I595T	possibly damaging	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Homo
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Slc8a2	T	C	7: 16,145,334	F582L	possibly damaging	Het
Sprr2e	A	G	3: 92,352,864	M1V	probably null	Het
Steap1	T	A	5: 5,740,827	R40S	possibly damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Tmem2	T	A	19: 21,802,005	V393E	probably damaging	Het
Tmprss13	A	G	9: 45,345,332	Y525C	probably damaging	Het
Tnik	A	T	3: 28,577,500	H383L	possibly damaging	Het
Vars	T	C	17: 35,013,743	L881S	probably damaging	Het
Vmn1r201	A	C	13: 22,475,215	S200R	probably damaging	Het
Vmn2r14	A	T	5: 109,221,267	W147R	probably benign	Het
Vmn2r-ps130	A	T	17: 23,076,785	H643L	probably benign	Het
Vps53	T	C	11: 76,102,018	E367G	probably benign	Het
Xab2	C	T	8: 3,611,822	G544S	probably damaging	Het
Ythdf3	T	A	3: 16,204,856	V400E	possibly damaging	Het
Zfand5	C	T	19: 21,279,696	P147S	probably benign	Het
Zfp768	A	T	7: 127,345,147		probably null	Het
Zswim8	A	G	14: 20,713,453	M423V	probably benign	Het

Other mutations in Thsd7a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00562:Thsd7a	APN	6	12379659	splice site	probably null
IGL00563:Thsd7a	APN	6	12379659	splice site	probably null
IGL00753:Thsd7a	APN	6	12327529	missense	probably damaging	1.00
IGL00835:Thsd7a	APN	6	12554934	missense	probably damaging	1.00
IGL01486:Thsd7a	APN	6	12471080	missense	probably damaging	1.00
IGL01730:Thsd7a	APN	6	12554981	missense	probably benign	0.05
IGL01931:Thsd7a	APN	6	12504099	missense	probably damaging	1.00
IGL01935:Thsd7a	APN	6	12317419	missense	probably damaging	1.00
IGL01978:Thsd7a	APN	6	12331006	missense	probably benign	0.01
IGL02233:Thsd7a	APN	6	12555258	missense	probably benign	0.00
IGL02354:Thsd7a	APN	6	12348193	splice site	probably benign
IGL02361:Thsd7a	APN	6	12348193	splice site	probably benign
IGL02375:Thsd7a	APN	6	12343265	missense	probably damaging	1.00
IGL02468:Thsd7a	APN	6	12318171	missense	probably damaging	0.98
IGL02616:Thsd7a	APN	6	12408985	missense	probably damaging	0.98
IGL02820:Thsd7a	APN	6	12321072	missense	probably damaging	1.00
IGL02858:Thsd7a	APN	6	12500995	missense	probably benign	0.16
IGL03074:Thsd7a	APN	6	12324681	missense	probably damaging	0.99
IGL03234:Thsd7a	APN	6	12343178	missense	probably damaging	1.00
IGL03244:Thsd7a	APN	6	12504168	splice site	probably benign
IGL03337:Thsd7a	APN	6	12405174	missense	probably damaging	1.00
G1patch:Thsd7a	UTSW	6	12555631	missense	possibly damaging	0.87
PIT4354001:Thsd7a	UTSW	6	12331927	critical splice donor site	probably null
R0095:Thsd7a	UTSW	6	12320970	missense	probably damaging	0.99
R0127:Thsd7a	UTSW	6	12554908	missense	probably benign	0.01
R0142:Thsd7a	UTSW	6	12418335	missense	probably damaging	1.00
R0226:Thsd7a	UTSW	6	12321900	missense	possibly damaging	0.94
R0242:Thsd7a	UTSW	6	12503916	missense	probably benign	0.32
R0242:Thsd7a	UTSW	6	12503916	missense	probably benign	0.32
R0359:Thsd7a	UTSW	6	12352031	missense	probably damaging	1.00
R0365:Thsd7a	UTSW	6	12321887	critical splice donor site	probably null
R0504:Thsd7a	UTSW	6	12379594	missense	probably damaging	0.99
R0512:Thsd7a	UTSW	6	12379605	missense	possibly damaging	0.67
R0540:Thsd7a	UTSW	6	12331542	splice site	probably null
R0577:Thsd7a	UTSW	6	12321048	missense	possibly damaging	0.50
R0607:Thsd7a	UTSW	6	12331542	splice site	probably null
R0755:Thsd7a	UTSW	6	12555369	missense	probably damaging	1.00
R0771:Thsd7a	UTSW	6	12327577	missense	probably benign	0.09
R0780:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0870:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0871:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0872:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0873:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R1102:Thsd7a	UTSW	6	12555702	missense	possibly damaging	0.58
R1144:Thsd7a	UTSW	6	12471027	splice site	probably benign
R1265:Thsd7a	UTSW	6	12317419	missense	probably damaging	0.99
R1276:Thsd7a	UTSW	6	12418370	missense	probably damaging	1.00
R1381:Thsd7a	UTSW	6	12555439	missense	probably damaging	1.00
R1473:Thsd7a	UTSW	6	12338622	missense	probably benign	0.08
R1519:Thsd7a	UTSW	6	12471175	missense	probably benign	0.01
R1633:Thsd7a	UTSW	6	12471104	nonsense	probably null
R1659:Thsd7a	UTSW	6	12504064	missense	possibly damaging	0.73
R1769:Thsd7a	UTSW	6	12555715	nonsense	probably null
R1824:Thsd7a	UTSW	6	12409042	splice site	probably null
R1840:Thsd7a	UTSW	6	12330974	missense	probably benign	0.03
R1845:Thsd7a	UTSW	6	12321041	missense	probably damaging	1.00
R1874:Thsd7a	UTSW	6	12555435	missense	possibly damaging	0.76
R2023:Thsd7a	UTSW	6	12327536	missense	probably benign	0.16
R2039:Thsd7a	UTSW	6	12408923	missense	possibly damaging	0.77
R2058:Thsd7a	UTSW	6	12318106	splice site	probably benign
R2138:Thsd7a	UTSW	6	12471073	nonsense	probably null
R2155:Thsd7a	UTSW	6	12379633	missense	probably damaging	1.00
R2175:Thsd7a	UTSW	6	12331944	missense	possibly damaging	0.95
R2216:Thsd7a	UTSW	6	12337268	missense	possibly damaging	0.95
R2318:Thsd7a	UTSW	6	12405147	missense	probably damaging	1.00
R2375:Thsd7a	UTSW	6	12337362	missense	probably damaging	1.00
R3857:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R3858:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R3890:Thsd7a	UTSW	6	12418337	missense	probably benign	0.09
R3910:Thsd7a	UTSW	6	12331549	missense	probably damaging	0.96
R3933:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R4369:Thsd7a	UTSW	6	12468908	missense	probably damaging	1.00
R4447:Thsd7a	UTSW	6	12324635	missense	probably damaging	0.98
R4664:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4664:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4665:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4665:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4666:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4666:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4668:Thsd7a	UTSW	6	12408968	missense	probably damaging	0.98
R4886:Thsd7a	UTSW	6	12327660	nonsense	probably null
R4918:Thsd7a	UTSW	6	12327559	missense	probably damaging	1.00
R4938:Thsd7a	UTSW	6	12330992	missense	probably benign	0.09
R5064:Thsd7a	UTSW	6	12330952	missense	possibly damaging	0.66
R5153:Thsd7a	UTSW	6	12338655	missense	probably benign	0.00
R5177:Thsd7a	UTSW	6	12379583	nonsense	probably null
R5242:Thsd7a	UTSW	6	12327583	missense	probably damaging	1.00
R5267:Thsd7a	UTSW	6	12379602	missense	probably damaging	1.00
R5442:Thsd7a	UTSW	6	12748800	missense	probably benign	0.00
R5506:Thsd7a	UTSW	6	12332017	missense	possibly damaging	0.85
R5525:Thsd7a	UTSW	6	12332007	missense	possibly damaging	0.52
R5544:Thsd7a	UTSW	6	12379471	missense	possibly damaging	0.94
R5651:Thsd7a	UTSW	6	12343213	missense	probably damaging	1.00
R5716:Thsd7a	UTSW	6	12343148	missense	probably benign	0.00
R5848:Thsd7a	UTSW	6	12503923	missense	probably damaging	1.00
R5958:Thsd7a	UTSW	6	12337262	missense	probably benign	0.02
R6012:Thsd7a	UTSW	6	12379389	splice site	probably null
R6139:Thsd7a	UTSW	6	12379573	missense	possibly damaging	0.93
R6243:Thsd7a	UTSW	6	12327602	missense	probably damaging	1.00
R6257:Thsd7a	UTSW	6	12408988	nonsense	probably null
R6300:Thsd7a	UTSW	6	12471104	nonsense	probably null
R6314:Thsd7a	UTSW	6	12554997	missense	possibly damaging	0.87
R6392:Thsd7a	UTSW	6	12468929	missense	probably damaging	0.99
R6418:Thsd7a	UTSW	6	12555082	nonsense	probably null
R6515:Thsd7a	UTSW	6	12501086	missense	possibly damaging	0.47
R6725:Thsd7a	UTSW	6	12555631	missense	possibly damaging	0.87
R6742:Thsd7a	UTSW	6	12408816	missense	probably damaging	1.00
R6776:Thsd7a	UTSW	6	12555637	missense	possibly damaging	0.53
R6838:Thsd7a	UTSW	6	12504075	missense	probably damaging	0.99
R7104:Thsd7a	UTSW	6	12379430	missense
R7170:Thsd7a	UTSW	6	12352091	missense
R7349:Thsd7a	UTSW	6	12352068	missense
R7460:Thsd7a	UTSW	6	12554934	missense
R7467:Thsd7a	UTSW	6	12331585	missense
R7666:Thsd7a	UTSW	6	12379438	missense
R7869:Thsd7a	UTSW	6	12471124	nonsense	probably null
R8032:Thsd7a	UTSW	6	12555288	missense
R8165:Thsd7a	UTSW	6	12468963	missense
R8167:Thsd7a	UTSW	6	12317401	nonsense	probably null
R8245:Thsd7a	UTSW	6	12379593	missense
R8310:Thsd7a	UTSW	6	12396613	missense
R8312:Thsd7a	UTSW	6	12471182	missense
R8331:Thsd7a	UTSW	6	12471158	missense
R8755:Thsd7a	UTSW	6	12408852	nonsense	probably null
R8843:Thsd7a	UTSW	6	12501137	missense
R8867:Thsd7a	UTSW	6	12338687	missense
R8952:Thsd7a	UTSW	6	12468993	missense	probably damaging	0.98
R9036:Thsd7a	UTSW	6	12418250	missense
R9299:Thsd7a	UTSW	6	12504132	missense
R9366:Thsd7a	UTSW	6	12555481	missense
R9489:Thsd7a	UTSW	6	12352023	missense

Predicted Primers

PCR Primer
(F):5'- GATCCTAGGTACAAGACTCAGAAG -3'
(R):5'- ATCAGTGCTTTGCAAGAGGTG -3'

Sequencing Primer
(F):5'- TACAAGACTCAGAAGTAGTTACAGC -3'
(R):5'- CACATCGGTGTCATCCTT -3'

Posted On

2018-03-15