Mutagenetix > Incidental Mutation

Incidental Mutation 'R6273:Plxnd1'

507456

Institutional Source

Beutler Lab

Gene Symbol

Plxnd1

Ensembl Gene

ENSMUSG00000030123

Gene Name

plexin D1

Synonyms

b2b553Clo, 6230425C21Rik, b2b1863Clo

MMRRC Submission

044443-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6273 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

115954811-115995005 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 115978492 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 538 (M538K)

Ref Sequence

ENSEMBL: ENSMUSP00000015511 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015511]

AlphaFold

Q3UH93

Predicted Effect

probably damaging
Transcript: ENSMUST00000015511
AA Change: M538K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: M538K

Domain	Start	End	E-Value	Type
signal peptide	1	48	N/A	INTRINSIC
Sema	61	531	6.52e-90	SMART
PSI	550	603	6.06e-12	SMART
PSI	703	755	1.06e-2	SMART
Blast:PSI	850	891	9e-20	BLAST
IPT	892	981	4.43e-20	SMART
IPT	982	1068	6.61e-19	SMART
IPT	1070	1149	6.13e-14	SMART
transmembrane domain	1271	1293	N/A	INTRINSIC
Pfam:Plexin_cytopl	1345	1888	5e-238	PFAM

Meta Mutation Damage Score

0.9536

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

98% (78/80)

MGI Phenotype

PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,218	I99N	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ankrd31	A	G	13: 96,851,673	I1065V	possibly damaging	Het
Aox2	A	G	1: 58,339,672	T1027A	probably benign	Het
Atm	G	A	9: 53,487,922	P1593L	probably benign	Het
Atp13a5	T	G	16: 29,348,737	I132L	probably benign	Het
BC035044	A	G	6: 128,890,889		probably benign	Het
C530008M17Rik	A	T	5: 76,857,721	D643V	unknown	Het
Cadm3	CT	C	1: 173,349,124		probably benign	Homo
Car3	C	T	3: 14,871,617	P247S	probably benign	Het
Ccdc7a	T	C	8: 128,787,338	Y160C	probably damaging	Het
Cd1d1	A	G	3: 86,998,257	V143A	probably benign	Het
Cog6	A	T	3: 52,996,052	F142I	probably damaging	Het
Crhr1	T	G	11: 104,163,856	N98K	possibly damaging	Het
Csf1	A	G	3: 107,749,163	V72A	probably damaging	Het
Cwc15	T	A	9: 14,510,241	I201K	probably benign	Het
Dgka	T	C	10: 128,723,646	K482R	probably benign	Het
Dnah7b	T	C	1: 46,242,316	S2846P	possibly damaging	Het
Dst	T	A	1: 34,275,266	I4199N	probably damaging	Het
Dusp7	A	G	9: 106,373,896	T407A	possibly damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fem1a	T	C	17: 56,257,083	Y59H	possibly damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Filip1	A	T	9: 79,815,886	D1150E	probably benign	Het
Gabra1	A	G	11: 42,140,311	V264A	probably damaging	Het
Gm4131	T	C	14: 62,464,850	E223G	probably damaging	Het
Gon4l	T	C	3: 88,855,849	V333A	probably damaging	Het
Gsk3b	A	G	16: 38,208,046	T289A	probably benign	Het
Hmcn2	T	C	2: 31,411,834	S2912P	probably damaging	Het
Htr7	A	T	19: 36,041,569		probably benign	Het
Ibsp	A	G	5: 104,310,301	T235A	probably benign	Het
Ints13	A	T	6: 146,565,681	D116E	probably damaging	Het
Kctd19	T	C	8: 105,385,485	N753S	probably benign	Het
Mdn1	A	G	4: 32,715,979	N2054D	probably benign	Het
Mink1	A	T	11: 70,611,435	K880*	probably null	Het
Mrvi1	G	T	7: 110,871,583	H848N	probably benign	Het
Myo15b	T	A	11: 115,862,799	L824Q	possibly damaging	Het
Napepld	T	C	5: 21,665,322	E366G	probably benign	Het
Obscn	T	A	11: 59,076,993	T2662S	possibly damaging	Het
Olfr130	T	G	17: 38,067,795	L208R	probably damaging	Het
Olfr1302	T	C	2: 111,781,222	F301L	probably benign	Het
Olfr133	T	A	17: 38,148,942	M118K	possibly damaging	Het
Olfr1448	A	G	19: 12,919,400	V303A	probably benign	Het
Olfr213	A	G	6: 116,541,316	T288A	possibly damaging	Het
Olfr656	A	G	7: 104,617,895	D72G	probably damaging	Het
Pah	T	C	10: 87,576,215		probably null	Het
Panx3	T	G	9: 37,667,429	I85L	probably benign	Het
Pate4	T	C	9: 35,607,790	N94D	probably benign	Het
Pde4d	A	G	13: 109,950,221	M610V	possibly damaging	Het
Pik3c2b	T	C	1: 133,066,711	S138P	probably benign	Het
Pkn1	T	C	8: 83,672,270	N696S	probably damaging	Het
Plppr2	A	G	9: 21,944,505	E258G	probably damaging	Het
Prepl	G	T	17: 85,083,268	N87K	probably benign	Het
Prkag2	C	A	5: 24,947,536	R190L	probably damaging	Het
Rara	A	G	11: 98,970,222	T179A	probably benign	Het
Rfx7	A	G	9: 72,616,997	K490E	possibly damaging	Het
Rgsl1	C	T	1: 153,827,465	V147M	possibly damaging	Het
Rph3a	A	G	5: 120,945,422	I595T	possibly damaging	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Homo
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Slc8a2	T	C	7: 16,145,334	F582L	possibly damaging	Het
Sprr2e	A	G	3: 92,352,864	M1V	probably null	Het
Steap1	T	A	5: 5,740,827	R40S	possibly damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Thsd7a	A	T	6: 12,408,836	V729E	probably damaging	Het
Tmem2	T	A	19: 21,802,005	V393E	probably damaging	Het
Tmprss13	A	G	9: 45,345,332	Y525C	probably damaging	Het
Tnik	A	T	3: 28,577,500	H383L	possibly damaging	Het
Vars	T	C	17: 35,013,743	L881S	probably damaging	Het
Vmn1r201	A	C	13: 22,475,215	S200R	probably damaging	Het
Vmn2r14	A	T	5: 109,221,267	W147R	probably benign	Het
Vmn2r-ps130	A	T	17: 23,076,785	H643L	probably benign	Het
Vps53	T	C	11: 76,102,018	E367G	probably benign	Het
Xab2	C	T	8: 3,611,822	G544S	probably damaging	Het
Ythdf3	T	A	3: 16,204,856	V400E	possibly damaging	Het
Zfand5	C	T	19: 21,279,696	P147S	probably benign	Het
Zfp768	A	T	7: 127,345,147		probably null	Het
Zswim8	A	G	14: 20,713,453	M423V	probably benign	Het

Other mutations in Plxnd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Plxnd1	APN	6	115967972	missense	possibly damaging	0.51
IGL01099:Plxnd1	APN	6	115969945	missense	probably benign
IGL01323:Plxnd1	APN	6	115966799	missense	possibly damaging	0.81
IGL01382:Plxnd1	APN	6	115960527	missense	probably damaging	1.00
IGL01786:Plxnd1	APN	6	115959935	missense	probably damaging	1.00
IGL02244:Plxnd1	APN	6	115978257	missense	probably benign	0.39
IGL02272:Plxnd1	APN	6	115993628	missense	probably damaging	1.00
IGL02293:Plxnd1	APN	6	115963913	missense	probably damaging	1.00
IGL02465:Plxnd1	APN	6	115955742	makesense	probably null
IGL02873:Plxnd1	APN	6	115959976	missense	probably damaging	1.00
IGL03209:Plxnd1	APN	6	115962357	missense	probably damaging	1.00
Hiss	UTSW	6	115969929	missense	possibly damaging	0.94
murmer	UTSW	6	115968793	missense	probably benign	0.00
mutter	UTSW	6	115968044	missense	probably benign	0.27
rattle	UTSW	6	115959794	missense	probably damaging	0.96
R0238:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0238:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0357:Plxnd1	UTSW	6	115969460	missense	probably benign	0.00
R0646:Plxnd1	UTSW	6	115958699	splice site	probably benign
R0648:Plxnd1	UTSW	6	115994001	missense	possibly damaging	0.86
R0718:Plxnd1	UTSW	6	115966638	missense	possibly damaging	0.68
R1116:Plxnd1	UTSW	6	115967005	splice site	probably null
R1292:Plxnd1	UTSW	6	115962683	unclassified	probably benign
R1715:Plxnd1	UTSW	6	115968681	missense	probably benign	0.02
R1760:Plxnd1	UTSW	6	115967779	missense	possibly damaging	0.95
R1799:Plxnd1	UTSW	6	115994057	missense	probably damaging	1.00
R1817:Plxnd1	UTSW	6	115980601	missense	possibly damaging	0.83
R1848:Plxnd1	UTSW	6	115966546	missense	probably damaging	1.00
R1851:Plxnd1	UTSW	6	115963914	missense	probably damaging	1.00
R1864:Plxnd1	UTSW	6	115969441	splice site	probably null
R1865:Plxnd1	UTSW	6	115969441	splice site	probably null
R1875:Plxnd1	UTSW	6	115978084	splice site	probably null
R1899:Plxnd1	UTSW	6	115969363	missense	probably benign
R1913:Plxnd1	UTSW	6	115978017	missense	possibly damaging	0.50
R1970:Plxnd1	UTSW	6	115962517	missense	probably damaging	1.00
R2007:Plxnd1	UTSW	6	115967255	missense	probably damaging	1.00
R2134:Plxnd1	UTSW	6	115957548	missense	probably damaging	1.00
R2202:Plxnd1	UTSW	6	115962764	missense	probably benign	0.45
R2230:Plxnd1	UTSW	6	115964144	missense	probably damaging	1.00
R2267:Plxnd1	UTSW	6	115962743	missense	probably benign	0.29
R2427:Plxnd1	UTSW	6	115967748	critical splice donor site	probably null
R4108:Plxnd1	UTSW	6	115959315	missense	probably damaging	1.00
R4233:Plxnd1	UTSW	6	115965953	missense	probably benign	0.30
R4280:Plxnd1	UTSW	6	115956094	splice site	probably benign
R4280:Plxnd1	UTSW	6	115956095	splice site	probably null
R4346:Plxnd1	UTSW	6	115977980	missense	probably benign	0.16
R4439:Plxnd1	UTSW	6	115993976	missense	probably damaging	0.99
R4572:Plxnd1	UTSW	6	115955756	missense	probably damaging	1.00
R4576:Plxnd1	UTSW	6	115968044	missense	probably benign	0.27
R4599:Plxnd1	UTSW	6	115994276	missense	probably damaging	1.00
R4614:Plxnd1	UTSW	6	115972525	missense	possibly damaging	0.83
R4700:Plxnd1	UTSW	6	115958615	missense	probably damaging	1.00
R4705:Plxnd1	UTSW	6	115958620	missense	probably damaging	1.00
R4806:Plxnd1	UTSW	6	115960855	missense	probably damaging	1.00
R4944:Plxnd1	UTSW	6	115955765	missense	probably damaging	1.00
R4977:Plxnd1	UTSW	6	115994376	missense	probably damaging	1.00
R5069:Plxnd1	UTSW	6	115965901	missense	probably damaging	0.98
R5155:Plxnd1	UTSW	6	115958988	critical splice donor site	probably null
R5460:Plxnd1	UTSW	6	115957648	missense	probably damaging	1.00
R5729:Plxnd1	UTSW	6	115965877	missense	probably damaging	1.00
R5909:Plxnd1	UTSW	6	115968688	missense	probably benign	0.00
R5992:Plxnd1	UTSW	6	115967787	critical splice acceptor site	probably null
R6129:Plxnd1	UTSW	6	115978174	missense	probably damaging	1.00
R6254:Plxnd1	UTSW	6	115977960	missense	probably benign	0.01
R6310:Plxnd1	UTSW	6	115976736	missense	possibly damaging	0.94
R6732:Plxnd1	UTSW	6	115969929	missense	possibly damaging	0.94
R6857:Plxnd1	UTSW	6	115993763	missense	probably benign	0.05
R7243:Plxnd1	UTSW	6	115972507	missense	probably benign	0.00
R7282:Plxnd1	UTSW	6	115960837	missense	probably damaging	1.00
R7632:Plxnd1	UTSW	6	115976639	missense	probably benign
R7699:Plxnd1	UTSW	6	115959794	missense	probably damaging	0.96
R7915:Plxnd1	UTSW	6	115966918	missense	probably benign	0.00
R8090:Plxnd1	UTSW	6	115956617	missense	probably damaging	1.00
R8382:Plxnd1	UTSW	6	115972472	missense	probably benign
R8507:Plxnd1	UTSW	6	115966905	missense	probably damaging	0.97
R8539:Plxnd1	UTSW	6	115962807	missense	possibly damaging	0.94
R8548:Plxnd1	UTSW	6	115957597	missense	probably damaging	1.00
R8963:Plxnd1	UTSW	6	115972545	nonsense	probably null
R9119:Plxnd1	UTSW	6	115955871	splice site	probably benign
R9177:Plxnd1	UTSW	6	115966508	missense	probably benign	0.00
R9182:Plxnd1	UTSW	6	115993785	missense	probably damaging	0.98
R9185:Plxnd1	UTSW	6	115957565	missense	probably damaging	1.00
R9226:Plxnd1	UTSW	6	115957563	missense	probably damaging	1.00
R9433:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R9449:Plxnd1	UTSW	6	115955769	missense	probably damaging	1.00
R9451:Plxnd1	UTSW	6	115963316	missense	possibly damaging	0.72
R9599:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
R9627:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
R9644:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
R9672:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
X0024:Plxnd1	UTSW	6	115963310	missense	probably benign	0.02
X0026:Plxnd1	UTSW	6	115966784	missense	possibly damaging	0.88
Z1088:Plxnd1	UTSW	6	115967510	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CTAACTCTGGAGGTATTAGTAGAGG -3'
(R):5'- TTTCACCCTGGAACATCTGAGC -3'

Sequencing Primer
(F):5'- GGTATGTGGGGGAAATATAGCCTC -3'
(R):5'- CCCTGGAACATCTGAGCAGGAG -3'

Posted On

2018-03-15