Incidental Mutation 'R6273:Zfp768'
ID507464
Institutional Source Beutler Lab
Gene Symbol Zfp768
Ensembl Gene ENSMUSG00000047371
Gene Namezinc finger protein 768
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R6273 (G1)
Quality Score92.0077
Status Validated
Chromosome7
Chromosomal Location127342795-127345589 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 127345147 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060783] [ENSMUST00000205266]
Predicted Effect probably null
Transcript: ENSMUST00000060783
SMART Domains Protein: ENSMUSP00000055374
Gene: ENSMUSG00000047371

DomainStartEndE-ValueType
low complexity region 62 80 N/A INTRINSIC
Pfam:RNA_pol_Rpb1_R 112 130 3.7e-4 PFAM
Pfam:RNA_pol_Rpb1_R 133 152 1.3e-4 PFAM
low complexity region 271 288 N/A INTRINSIC
ZnF_C2H2 289 311 7.15e-2 SMART
ZnF_C2H2 317 339 1.22e-4 SMART
ZnF_C2H2 345 367 1.5e-4 SMART
ZnF_C2H2 373 395 4.3e-5 SMART
ZnF_C2H2 401 423 4.24e-4 SMART
ZnF_C2H2 429 451 9.58e-3 SMART
ZnF_C2H2 457 479 1.47e-3 SMART
ZnF_C2H2 485 507 7.49e-5 SMART
ZnF_C2H2 513 535 1.03e-2 SMART
ZnF_C2H2 541 563 6.52e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000205266
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (78/80)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,218 I99N probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ankrd31 A G 13: 96,851,673 I1065V possibly damaging Het
Aox2 A G 1: 58,339,672 T1027A probably benign Het
Atm G A 9: 53,487,922 P1593L probably benign Het
Atp13a5 T G 16: 29,348,737 I132L probably benign Het
BC035044 A G 6: 128,890,889 probably benign Het
C530008M17Rik A T 5: 76,857,721 D643V unknown Het
Cadm3 CT C 1: 173,349,124 probably benign Homo
Car3 C T 3: 14,871,617 P247S probably benign Het
Ccdc7a T C 8: 128,787,338 Y160C probably damaging Het
Cd1d1 A G 3: 86,998,257 V143A probably benign Het
Cog6 A T 3: 52,996,052 F142I probably damaging Het
Crhr1 T G 11: 104,163,856 N98K possibly damaging Het
Csf1 A G 3: 107,749,163 V72A probably damaging Het
Cwc15 T A 9: 14,510,241 I201K probably benign Het
Dgka T C 10: 128,723,646 K482R probably benign Het
Dnah7b T C 1: 46,242,316 S2846P possibly damaging Het
Dst T A 1: 34,275,266 I4199N probably damaging Het
Dusp7 A G 9: 106,373,896 T407A possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fem1a T C 17: 56,257,083 Y59H possibly damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Filip1 A T 9: 79,815,886 D1150E probably benign Het
Gabra1 A G 11: 42,140,311 V264A probably damaging Het
Gm4131 T C 14: 62,464,850 E223G probably damaging Het
Gon4l T C 3: 88,855,849 V333A probably damaging Het
Gsk3b A G 16: 38,208,046 T289A probably benign Het
Hmcn2 T C 2: 31,411,834 S2912P probably damaging Het
Htr7 A T 19: 36,041,569 probably benign Het
Ibsp A G 5: 104,310,301 T235A probably benign Het
Ints13 A T 6: 146,565,681 D116E probably damaging Het
Kctd19 T C 8: 105,385,485 N753S probably benign Het
Mdn1 A G 4: 32,715,979 N2054D probably benign Het
Mink1 A T 11: 70,611,435 K880* probably null Het
Mrvi1 G T 7: 110,871,583 H848N probably benign Het
Myo15b T A 11: 115,862,799 L824Q possibly damaging Het
Napepld T C 5: 21,665,322 E366G probably benign Het
Obscn T A 11: 59,076,993 T2662S possibly damaging Het
Olfr130 T G 17: 38,067,795 L208R probably damaging Het
Olfr1302 T C 2: 111,781,222 F301L probably benign Het
Olfr133 T A 17: 38,148,942 M118K possibly damaging Het
Olfr1448 A G 19: 12,919,400 V303A probably benign Het
Olfr213 A G 6: 116,541,316 T288A possibly damaging Het
Olfr656 A G 7: 104,617,895 D72G probably damaging Het
Pah T C 10: 87,576,215 probably null Het
Panx3 T G 9: 37,667,429 I85L probably benign Het
Pate4 T C 9: 35,607,790 N94D probably benign Het
Pde4d A G 13: 109,950,221 M610V possibly damaging Het
Pik3c2b T C 1: 133,066,711 S138P probably benign Het
Pkn1 T C 8: 83,672,270 N696S probably damaging Het
Plppr2 A G 9: 21,944,505 E258G probably damaging Het
Plxnd1 A T 6: 115,978,492 M538K probably damaging Het
Prepl G T 17: 85,083,268 N87K probably benign Het
Prkag2 C A 5: 24,947,536 R190L probably damaging Het
Rara A G 11: 98,970,222 T179A probably benign Het
Rfx7 A G 9: 72,616,997 K490E possibly damaging Het
Rgsl1 C T 1: 153,827,465 V147M possibly damaging Het
Rph3a A G 5: 120,945,422 I595T possibly damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc8a2 T C 7: 16,145,334 F582L possibly damaging Het
Sprr2e A G 3: 92,352,864 M1V probably null Het
Steap1 T A 5: 5,740,827 R40S possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thsd7a A T 6: 12,408,836 V729E probably damaging Het
Tmem2 T A 19: 21,802,005 V393E probably damaging Het
Tmprss13 A G 9: 45,345,332 Y525C probably damaging Het
Tnik A T 3: 28,577,500 H383L possibly damaging Het
Vars T C 17: 35,013,743 L881S probably damaging Het
Vmn1r201 A C 13: 22,475,215 S200R probably damaging Het
Vmn2r14 A T 5: 109,221,267 W147R probably benign Het
Vmn2r-ps130 A T 17: 23,076,785 H643L probably benign Het
Vps53 T C 11: 76,102,018 E367G probably benign Het
Xab2 C T 8: 3,611,822 G544S probably damaging Het
Ythdf3 T A 3: 16,204,856 V400E possibly damaging Het
Zfand5 C T 19: 21,279,696 P147S probably benign Het
Zswim8 A G 14: 20,713,453 M423V probably benign Het
Other mutations in Zfp768
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Zfp768 APN 7 127344531 missense possibly damaging 0.80
IGL03236:Zfp768 APN 7 127343970 missense possibly damaging 0.93
R1490:Zfp768 UTSW 7 127343631 missense probably damaging 1.00
R1497:Zfp768 UTSW 7 127343561 missense probably damaging 1.00
R2251:Zfp768 UTSW 7 127344378 missense probably benign
R2298:Zfp768 UTSW 7 127344189 missense probably benign 0.11
R2360:Zfp768 UTSW 7 127344638 missense probably benign 0.43
R4751:Zfp768 UTSW 7 127344762 missense possibly damaging 0.94
R4795:Zfp768 UTSW 7 127343375 missense possibly damaging 0.60
R5011:Zfp768 UTSW 7 127343703 missense probably damaging 1.00
R5518:Zfp768 UTSW 7 127344411 missense probably benign
R5602:Zfp768 UTSW 7 127344632 missense possibly damaging 0.73
R5876:Zfp768 UTSW 7 127344546 missense probably benign 0.01
R6245:Zfp768 UTSW 7 127344091 nonsense probably null
R6376:Zfp768 UTSW 7 127344720 missense probably benign 0.34
R6475:Zfp768 UTSW 7 127344655 missense probably damaging 0.97
R7125:Zfp768 UTSW 7 127344787 missense probably damaging 0.98
R7905:Zfp768 UTSW 7 127344659 missense probably damaging 0.99
R7988:Zfp768 UTSW 7 127344659 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCATTGGCCCCTACAAGTG -3'
(R):5'- AATGCCAACGAGTTTCCACC -3'

Sequencing Primer
(F):5'- ATTGGCCCCTACAAGTGAGGTG -3'
(R):5'- TCTCCTCGGAGGCTCTGAAC -3'
Posted On2018-03-15