Incidental Mutation 'R6273:Pkn1'
ID507466
Institutional Source Beutler Lab
Gene Symbol Pkn1
Ensembl Gene ENSMUSG00000057672
Gene Nameprotein kinase N1
SynonymsPRK1, F730027O18Rik, PAK1, Prkcl1, Pkn, Stk3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6273 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location83666536-83699179 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83672270 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 696 (N696S)
Ref Sequence ENSEMBL: ENSMUSP00000115054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005616] [ENSMUST00000019608] [ENSMUST00000132945] [ENSMUST00000144258]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005616
AA Change: N684S

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000005616
Gene: ENSMUSG00000057672
AA Change: N684S

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Hr1 37 101 6.74e-20 SMART
Hr1 126 194 1.13e-21 SMART
Hr1 216 284 7.79e-25 SMART
C2 328 464 2.45e-1 SMART
low complexity region 569 601 N/A INTRINSIC
S_TKc 619 878 2.83e-96 SMART
S_TK_X 879 943 5.29e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019608
SMART Domains Protein: ENSMUSP00000019608
Gene: ENSMUSG00000019464

DomainStartEndE-ValueType
Pfam:7tm_1 52 354 2.3e-17 PFAM
low complexity region 356 372 N/A INTRINSIC
low complexity region 392 405 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128523
Predicted Effect probably damaging
Transcript: ENSMUST00000132945
AA Change: N696S

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115054
Gene: ENSMUSG00000057672
AA Change: N696S

DomainStartEndE-ValueType
low complexity region 27 42 N/A INTRINSIC
Hr1 49 113 6.74e-20 SMART
Hr1 138 206 1.13e-21 SMART
Hr1 228 296 7.79e-25 SMART
C2 340 476 2.45e-1 SMART
low complexity region 581 613 N/A INTRINSIC
Pfam:Pkinase 631 756 2.2e-23 PFAM
Pfam:Pkinase_Tyr 631 757 1.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138898
Predicted Effect probably benign
Transcript: ENSMUST00000144258
AA Change: N689S

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116235
Gene: ENSMUSG00000057672
AA Change: N689S

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Hr1 42 106 6.74e-20 SMART
Hr1 131 199 1.13e-21 SMART
Hr1 221 289 7.79e-25 SMART
C2 333 469 2.45e-1 SMART
low complexity region 574 606 N/A INTRINSIC
S_TKc 624 883 2.83e-96 SMART
S_TK_X 884 948 5.29e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212519
Meta Mutation Damage Score 0.0960 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (78/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase C superfamily. This kinase is activated by Rho family of small G proteins and may mediate the Rho-dependent signaling pathway. This kinase can be activated by phospholipids and by limited proteolysis. The 3-phosphoinositide dependent protein kinase-1 (PDPK1/PDK1) is reported to phosphorylate this kinase, which may mediate insulin signals to the actin cytoskeleton. The proteolytic activation of this kinase by caspase-3 or related proteases during apoptosis suggests its role in signal transduction related to apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spontaneously formed GCs and developed an autoimmune-like disease with autoantibody production and glomerulonephritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,218 I99N probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ankrd31 A G 13: 96,851,673 I1065V possibly damaging Het
Aox2 A G 1: 58,339,672 T1027A probably benign Het
Atm G A 9: 53,487,922 P1593L probably benign Het
Atp13a5 T G 16: 29,348,737 I132L probably benign Het
BC035044 A G 6: 128,890,889 probably benign Het
C530008M17Rik A T 5: 76,857,721 D643V unknown Het
Cadm3 CT C 1: 173,349,124 probably benign Homo
Car3 C T 3: 14,871,617 P247S probably benign Het
Ccdc7a T C 8: 128,787,338 Y160C probably damaging Het
Cd1d1 A G 3: 86,998,257 V143A probably benign Het
Cog6 A T 3: 52,996,052 F142I probably damaging Het
Crhr1 T G 11: 104,163,856 N98K possibly damaging Het
Csf1 A G 3: 107,749,163 V72A probably damaging Het
Cwc15 T A 9: 14,510,241 I201K probably benign Het
Dgka T C 10: 128,723,646 K482R probably benign Het
Dnah7b T C 1: 46,242,316 S2846P possibly damaging Het
Dst T A 1: 34,275,266 I4199N probably damaging Het
Dusp7 A G 9: 106,373,896 T407A possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fem1a T C 17: 56,257,083 Y59H possibly damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Filip1 A T 9: 79,815,886 D1150E probably benign Het
Gabra1 A G 11: 42,140,311 V264A probably damaging Het
Gm4131 T C 14: 62,464,850 E223G probably damaging Het
Gon4l T C 3: 88,855,849 V333A probably damaging Het
Gsk3b A G 16: 38,208,046 T289A probably benign Het
Hmcn2 T C 2: 31,411,834 S2912P probably damaging Het
Htr7 A T 19: 36,041,569 probably benign Het
Ibsp A G 5: 104,310,301 T235A probably benign Het
Ints13 A T 6: 146,565,681 D116E probably damaging Het
Kctd19 T C 8: 105,385,485 N753S probably benign Het
Mdn1 A G 4: 32,715,979 N2054D probably benign Het
Mink1 A T 11: 70,611,435 K880* probably null Het
Mrvi1 G T 7: 110,871,583 H848N probably benign Het
Myo15b T A 11: 115,862,799 L824Q possibly damaging Het
Napepld T C 5: 21,665,322 E366G probably benign Het
Obscn T A 11: 59,076,993 T2662S possibly damaging Het
Olfr130 T G 17: 38,067,795 L208R probably damaging Het
Olfr1302 T C 2: 111,781,222 F301L probably benign Het
Olfr133 T A 17: 38,148,942 M118K possibly damaging Het
Olfr1448 A G 19: 12,919,400 V303A probably benign Het
Olfr213 A G 6: 116,541,316 T288A possibly damaging Het
Olfr656 A G 7: 104,617,895 D72G probably damaging Het
Pah T C 10: 87,576,215 probably null Het
Panx3 T G 9: 37,667,429 I85L probably benign Het
Pate4 T C 9: 35,607,790 N94D probably benign Het
Pde4d A G 13: 109,950,221 M610V possibly damaging Het
Pik3c2b T C 1: 133,066,711 S138P probably benign Het
Plppr2 A G 9: 21,944,505 E258G probably damaging Het
Plxnd1 A T 6: 115,978,492 M538K probably damaging Het
Prepl G T 17: 85,083,268 N87K probably benign Het
Prkag2 C A 5: 24,947,536 R190L probably damaging Het
Rara A G 11: 98,970,222 T179A probably benign Het
Rfx7 A G 9: 72,616,997 K490E possibly damaging Het
Rgsl1 C T 1: 153,827,465 V147M possibly damaging Het
Rph3a A G 5: 120,945,422 I595T possibly damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc8a2 T C 7: 16,145,334 F582L possibly damaging Het
Sprr2e A G 3: 92,352,864 M1V probably null Het
Steap1 T A 5: 5,740,827 R40S possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thsd7a A T 6: 12,408,836 V729E probably damaging Het
Tmem2 T A 19: 21,802,005 V393E probably damaging Het
Tmprss13 A G 9: 45,345,332 Y525C probably damaging Het
Tnik A T 3: 28,577,500 H383L possibly damaging Het
Vars T C 17: 35,013,743 L881S probably damaging Het
Vmn1r201 A C 13: 22,475,215 S200R probably damaging Het
Vmn2r14 A T 5: 109,221,267 W147R probably benign Het
Vmn2r-ps130 A T 17: 23,076,785 H643L probably benign Het
Vps53 T C 11: 76,102,018 E367G probably benign Het
Xab2 C T 8: 3,611,822 G544S probably damaging Het
Ythdf3 T A 3: 16,204,856 V400E possibly damaging Het
Zfand5 C T 19: 21,279,696 P147S probably benign Het
Zfp768 A T 7: 127,345,147 probably null Het
Zswim8 A G 14: 20,713,453 M423V probably benign Het
Other mutations in Pkn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Pkn1 APN 8 83681006 missense probably damaging 0.96
IGL02058:Pkn1 APN 8 83681225 nonsense probably null
IGL03142:Pkn1 APN 8 83671023 missense possibly damaging 0.85
Xinjiang UTSW 8 83692927 nonsense probably null
R0115:Pkn1 UTSW 8 83671029 missense probably damaging 0.99
R0157:Pkn1 UTSW 8 83692820 missense probably damaging 1.00
R0304:Pkn1 UTSW 8 83683607 splice site probably benign
R0450:Pkn1 UTSW 8 83672324 missense probably damaging 1.00
R0469:Pkn1 UTSW 8 83672324 missense probably damaging 1.00
R1419:Pkn1 UTSW 8 83673522 missense probably damaging 0.99
R1539:Pkn1 UTSW 8 83670337 missense possibly damaging 0.49
R2025:Pkn1 UTSW 8 83671378 missense probably damaging 1.00
R2026:Pkn1 UTSW 8 83671378 missense probably damaging 1.00
R2027:Pkn1 UTSW 8 83671378 missense probably damaging 1.00
R2029:Pkn1 UTSW 8 83677963 missense possibly damaging 0.92
R2886:Pkn1 UTSW 8 83681238 missense probably benign 0.28
R3017:Pkn1 UTSW 8 83670170 missense probably benign 0.13
R3402:Pkn1 UTSW 8 83670230 missense probably damaging 1.00
R4110:Pkn1 UTSW 8 83691199 missense probably benign 0.41
R4504:Pkn1 UTSW 8 83692927 nonsense probably null
R4739:Pkn1 UTSW 8 83671749 missense probably damaging 0.98
R4838:Pkn1 UTSW 8 83677966 missense probably damaging 1.00
R4857:Pkn1 UTSW 8 83684227 splice site probably null
R5239:Pkn1 UTSW 8 83684182 missense probably damaging 1.00
R5558:Pkn1 UTSW 8 83684722 missense probably damaging 1.00
R5613:Pkn1 UTSW 8 83677761 missense probably benign 0.00
R6169:Pkn1 UTSW 8 83681206 nonsense probably null
R6172:Pkn1 UTSW 8 83670755 missense possibly damaging 0.48
R6318:Pkn1 UTSW 8 83683591 missense probably damaging 1.00
R6531:Pkn1 UTSW 8 83670293 missense probably benign 0.09
R6969:Pkn1 UTSW 8 83683426 missense probably damaging 1.00
R7142:Pkn1 UTSW 8 83693967 missense possibly damaging 0.50
R7157:Pkn1 UTSW 8 83671734 missense probably damaging 1.00
R7189:Pkn1 UTSW 8 83692673 missense possibly damaging 0.74
R7981:Pkn1 UTSW 8 83681008 missense probably damaging 0.99
Z1176:Pkn1 UTSW 8 83673497 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCCTCAGGCACCAAAGTC -3'
(R):5'- CGCTCAAAATTGCACAGCGG -3'

Sequencing Primer
(F):5'- TCCCAAAGCTGTGCAGGAG -3'
(R):5'- GTGCAACTCAACAGATACCTGAGTG -3'
Posted On2018-03-15