Incidental Mutation 'R6273:Mink1'
ID507482
Institutional Source Beutler Lab
Gene Symbol Mink1
Ensembl Gene ENSMUSG00000020827
Gene Namemisshapen-like kinase 1 (zebrafish)
SynonymsMap4k6, Ysk2, MINK, Misshapen/NIKs-related kinase
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6273 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location70562881-70614483 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 70611435 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 880 (K880*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014753] [ENSMUST00000072237] [ENSMUST00000072873] [ENSMUST00000079244] [ENSMUST00000102556] [ENSMUST00000102558] [ENSMUST00000102559] [ENSMUST00000135865] [ENSMUST00000144960] [ENSMUST00000180052]
Predicted Effect probably benign
Transcript: ENSMUST00000014753
SMART Domains Protein: ENSMUSP00000014753
Gene: ENSMUSG00000014609

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Neur_chan_LBD 24 240 2.9e-65 PFAM
Pfam:Neur_chan_memb 247 475 6.5e-58 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000072237
AA Change: K1027*
SMART Domains Protein: ENSMUSP00000072091
Gene: ENSMUSG00000020827
AA Change: K1027*

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 837 874 N/A INTRINSIC
CNH 1026 1324 1.58e-113 SMART
Predicted Effect probably null
Transcript: ENSMUST00000072873
AA Change: K1020*
SMART Domains Protein: ENSMUSP00000072649
Gene: ENSMUSG00000020827
AA Change: K1020*

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 829 853 N/A INTRINSIC
CNH 1019 1317 1.58e-113 SMART
Predicted Effect probably null
Transcript: ENSMUST00000079244
AA Change: K1017*
SMART Domains Protein: ENSMUSP00000078234
Gene: ENSMUSG00000020827
AA Change: K1017*

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 314 338 N/A INTRINSIC
coiled coil region 348 493 N/A INTRINSIC
low complexity region 554 566 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 826 850 N/A INTRINSIC
CNH 1016 1314 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102556
SMART Domains Protein: ENSMUSP00000099616
Gene: ENSMUSG00000014609

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Neur_chan_LBD 24 240 5.4e-65 PFAM
Pfam:Neur_chan_memb 247 474 2.9e-53 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102558
AA Change: K983*
SMART Domains Protein: ENSMUSP00000099618
Gene: ENSMUSG00000020827
AA Change: K983*

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 792 816 N/A INTRINSIC
CNH 982 1280 1.58e-113 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102559
AA Change: K991*
SMART Domains Protein: ENSMUSP00000099619
Gene: ENSMUSG00000020827
AA Change: K991*

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 800 824 N/A INTRINSIC
CNH 990 1288 1.58e-113 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134836
Predicted Effect probably benign
Transcript: ENSMUST00000135865
SMART Domains Protein: ENSMUSP00000135933
Gene: ENSMUSG00000087279

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 101 107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135920
Predicted Effect probably null
Transcript: ENSMUST00000136663
AA Change: K880*
SMART Domains Protein: ENSMUSP00000117959
Gene: ENSMUSG00000020827
AA Change: K880*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 140 2.3e-22 PFAM
Pfam:Pkinase 1 143 1.6e-30 PFAM
low complexity region 161 192 N/A INTRINSIC
coiled coil region 204 349 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 474 487 N/A INTRINSIC
low complexity region 500 513 N/A INTRINSIC
low complexity region 573 592 N/A INTRINSIC
low complexity region 691 728 N/A INTRINSIC
CNH 880 1178 1.58e-113 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142650
Predicted Effect probably benign
Transcript: ENSMUST00000144960
SMART Domains Protein: ENSMUSP00000136077
Gene: ENSMUSG00000087279

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153503
Predicted Effect probably benign
Transcript: ENSMUST00000178764
Predicted Effect probably benign
Transcript: ENSMUST00000180052
SMART Domains Protein: ENSMUSP00000137259
Gene: ENSMUSG00000087279

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (78/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase belonging to the germinal center kinase (GCK) family. The protein is structurally similar to the kinases that are related to NIK and may belong to a distinct subfamily of NIK-related kinases within the GCK family. Studies of the mouse homolog indicate an up-regulation of expression in the course of postnatal mouse cerebral development and activation of the cJun N-terminal kinase (JNK) and the p38 pathways. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,218 I99N probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ankrd31 A G 13: 96,851,673 I1065V possibly damaging Het
Aox2 A G 1: 58,339,672 T1027A probably benign Het
Atm G A 9: 53,487,922 P1593L probably benign Het
Atp13a5 T G 16: 29,348,737 I132L probably benign Het
BC035044 A G 6: 128,890,889 probably benign Het
C530008M17Rik A T 5: 76,857,721 D643V unknown Het
Cadm3 CT C 1: 173,349,124 probably benign Homo
Car3 C T 3: 14,871,617 P247S probably benign Het
Ccdc7a T C 8: 128,787,338 Y160C probably damaging Het
Cd1d1 A G 3: 86,998,257 V143A probably benign Het
Cog6 A T 3: 52,996,052 F142I probably damaging Het
Crhr1 T G 11: 104,163,856 N98K possibly damaging Het
Csf1 A G 3: 107,749,163 V72A probably damaging Het
Cwc15 T A 9: 14,510,241 I201K probably benign Het
Dgka T C 10: 128,723,646 K482R probably benign Het
Dnah7b T C 1: 46,242,316 S2846P possibly damaging Het
Dst T A 1: 34,275,266 I4199N probably damaging Het
Dusp7 A G 9: 106,373,896 T407A possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fem1a T C 17: 56,257,083 Y59H possibly damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Filip1 A T 9: 79,815,886 D1150E probably benign Het
Gabra1 A G 11: 42,140,311 V264A probably damaging Het
Gm4131 T C 14: 62,464,850 E223G probably damaging Het
Gon4l T C 3: 88,855,849 V333A probably damaging Het
Gsk3b A G 16: 38,208,046 T289A probably benign Het
Hmcn2 T C 2: 31,411,834 S2912P probably damaging Het
Htr7 A T 19: 36,041,569 probably benign Het
Ibsp A G 5: 104,310,301 T235A probably benign Het
Ints13 A T 6: 146,565,681 D116E probably damaging Het
Kctd19 T C 8: 105,385,485 N753S probably benign Het
Mdn1 A G 4: 32,715,979 N2054D probably benign Het
Mrvi1 G T 7: 110,871,583 H848N probably benign Het
Myo15b T A 11: 115,862,799 L824Q possibly damaging Het
Napepld T C 5: 21,665,322 E366G probably benign Het
Obscn T A 11: 59,076,993 T2662S possibly damaging Het
Olfr130 T G 17: 38,067,795 L208R probably damaging Het
Olfr1302 T C 2: 111,781,222 F301L probably benign Het
Olfr133 T A 17: 38,148,942 M118K possibly damaging Het
Olfr1448 A G 19: 12,919,400 V303A probably benign Het
Olfr213 A G 6: 116,541,316 T288A possibly damaging Het
Olfr656 A G 7: 104,617,895 D72G probably damaging Het
Pah T C 10: 87,576,215 probably null Het
Panx3 T G 9: 37,667,429 I85L probably benign Het
Pate4 T C 9: 35,607,790 N94D probably benign Het
Pde4d A G 13: 109,950,221 M610V possibly damaging Het
Pik3c2b T C 1: 133,066,711 S138P probably benign Het
Pkn1 T C 8: 83,672,270 N696S probably damaging Het
Plppr2 A G 9: 21,944,505 E258G probably damaging Het
Plxnd1 A T 6: 115,978,492 M538K probably damaging Het
Prepl G T 17: 85,083,268 N87K probably benign Het
Prkag2 C A 5: 24,947,536 R190L probably damaging Het
Rara A G 11: 98,970,222 T179A probably benign Het
Rfx7 A G 9: 72,616,997 K490E possibly damaging Het
Rgsl1 C T 1: 153,827,465 V147M possibly damaging Het
Rph3a A G 5: 120,945,422 I595T possibly damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc8a2 T C 7: 16,145,334 F582L possibly damaging Het
Sprr2e A G 3: 92,352,864 M1V probably null Het
Steap1 T A 5: 5,740,827 R40S possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Thsd7a A T 6: 12,408,836 V729E probably damaging Het
Tmem2 T A 19: 21,802,005 V393E probably damaging Het
Tmprss13 A G 9: 45,345,332 Y525C probably damaging Het
Tnik A T 3: 28,577,500 H383L possibly damaging Het
Vars T C 17: 35,013,743 L881S probably damaging Het
Vmn1r201 A C 13: 22,475,215 S200R probably damaging Het
Vmn2r14 A T 5: 109,221,267 W147R probably benign Het
Vmn2r-ps130 A T 17: 23,076,785 H643L probably benign Het
Vps53 T C 11: 76,102,018 E367G probably benign Het
Xab2 C T 8: 3,611,822 G544S probably damaging Het
Ythdf3 T A 3: 16,204,856 V400E possibly damaging Het
Zfand5 C T 19: 21,279,696 P147S probably benign Het
Zfp768 A T 7: 127,345,147 probably null Het
Zswim8 A G 14: 20,713,453 M423V probably benign Het
Other mutations in Mink1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Mink1 APN 11 70603812 missense probably damaging 0.99
IGL00709:Mink1 APN 11 70613019 missense probably damaging 0.99
IGL01064:Mink1 APN 11 70603481 missense probably benign 0.05
IGL02612:Mink1 APN 11 70597226 missense probably damaging 1.00
IGL02797:Mink1 APN 11 70610350 missense probably damaging 1.00
IGL03056:Mink1 APN 11 70612583 critical splice donor site probably null
IGL03066:Mink1 APN 11 70608889 missense probably benign 0.01
IGL03185:Mink1 APN 11 70603860 missense probably damaging 1.00
PIT4498001:Mink1 UTSW 11 70598888 missense probably benign 0.05
R0025:Mink1 UTSW 11 70613042 missense probably damaging 1.00
R0025:Mink1 UTSW 11 70613042 missense probably damaging 1.00
R0488:Mink1 UTSW 11 70597204 missense probably damaging 1.00
R0637:Mink1 UTSW 11 70601676 missense probably damaging 0.96
R0828:Mink1 UTSW 11 70610145 nonsense probably null
R1081:Mink1 UTSW 11 70607035 missense probably benign 0.07
R1175:Mink1 UTSW 11 70611340 missense probably benign 0.02
R1441:Mink1 UTSW 11 70607114 missense possibly damaging 0.72
R1532:Mink1 UTSW 11 70602007 missense probably null 1.00
R1545:Mink1 UTSW 11 70598891 missense possibly damaging 0.60
R1634:Mink1 UTSW 11 70608880 missense probably benign 0.00
R1932:Mink1 UTSW 11 70608428 critical splice donor site probably null
R2033:Mink1 UTSW 11 70612508 missense probably damaging 1.00
R2184:Mink1 UTSW 11 70603797 missense probably damaging 1.00
R2267:Mink1 UTSW 11 70601724 splice site probably null
R2268:Mink1 UTSW 11 70601724 splice site probably null
R2859:Mink1 UTSW 11 70612508 missense probably damaging 1.00
R3713:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3714:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3715:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3716:Mink1 UTSW 11 70607761 missense probably damaging 0.98
R3717:Mink1 UTSW 11 70607761 missense probably damaging 0.98
R4607:Mink1 UTSW 11 70606067 missense possibly damaging 0.72
R4735:Mink1 UTSW 11 70609260 splice site probably null
R4790:Mink1 UTSW 11 70599041 missense probably damaging 0.99
R4847:Mink1 UTSW 11 70602028 missense probably damaging 1.00
R4860:Mink1 UTSW 11 70611592 missense probably damaging 0.98
R4860:Mink1 UTSW 11 70611592 missense probably damaging 0.98
R5081:Mink1 UTSW 11 70605144 missense probably damaging 0.98
R5310:Mink1 UTSW 11 70607343 missense probably benign 0.33
R5677:Mink1 UTSW 11 70605165 missense possibly damaging 0.66
R5767:Mink1 UTSW 11 70606075 missense possibly damaging 0.53
R5795:Mink1 UTSW 11 70607790 missense possibly damaging 0.86
R5888:Mink1 UTSW 11 70610059 unclassified probably benign
R5950:Mink1 UTSW 11 70609586 missense possibly damaging 0.81
R6024:Mink1 UTSW 11 70599089 missense possibly damaging 0.71
R6034:Mink1 UTSW 11 70607040 small deletion probably benign
R6034:Mink1 UTSW 11 70607040 small deletion probably benign
R6058:Mink1 UTSW 11 70611720 missense possibly damaging 0.96
R6144:Mink1 UTSW 11 70610652 missense possibly damaging 0.66
R6154:Mink1 UTSW 11 70610101 missense possibly damaging 0.46
R6218:Mink1 UTSW 11 70598894 missense possibly damaging 0.94
R6262:Mink1 UTSW 11 70603325 splice site probably null
R6269:Mink1 UTSW 11 70598987 missense probably damaging 1.00
R6301:Mink1 UTSW 11 70612294 missense possibly damaging 0.71
R6603:Mink1 UTSW 11 70609593 missense probably damaging 0.96
R6876:Mink1 UTSW 11 70607435 missense probably benign 0.02
R7030:Mink1 UTSW 11 70607775 missense possibly damaging 0.46
R7050:Mink1 UTSW 11 70612332 missense possibly damaging 0.93
R7094:Mink1 UTSW 11 70610075 splice site probably null
R7135:Mink1 UTSW 11 70603503 missense probably damaging 1.00
R7238:Mink1 UTSW 11 70611479 critical splice donor site probably null
R7320:Mink1 UTSW 11 70599073 missense probably benign 0.23
R7396:Mink1 UTSW 11 70605168 missense possibly damaging 0.73
R7446:Mink1 UTSW 11 70609629 missense probably benign 0.18
R7723:Mink1 UTSW 11 70612910 missense probably benign 0.16
R7896:Mink1 UTSW 11 70612282 missense possibly damaging 0.71
R7979:Mink1 UTSW 11 70612282 missense possibly damaging 0.71
R8058:Mink1 UTSW 11 70603768 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGATGTGCCCAGATGAGATG -3'
(R):5'- GCAACATCAGCCCATTCTCTG -3'

Sequencing Primer
(F):5'- GGCATAGGAGTAGAAATAACCACTG -3'
(R):5'- ATTCTCTGTGCCCACTAGGAGG -3'
Posted On2018-03-15