Incidental Mutation 'R6273:Pde4d'
ID 507489
Institutional Source Beutler Lab
Gene Symbol Pde4d
Ensembl Gene ENSMUSG00000021699
Gene Name phosphodiesterase 4D, cAMP specific
Synonyms 9630011N22Rik, dunce, Dpde3
MMRRC Submission 044443-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6273 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 108790711-110092503 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110086755 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 610 (M610V)
Ref Sequence ENSEMBL: ENSMUSP00000112991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074103] [ENSMUST00000079975] [ENSMUST00000117420] [ENSMUST00000117879] [ENSMUST00000119507] [ENSMUST00000119672] [ENSMUST00000120664] [ENSMUST00000120671] [ENSMUST00000122041] [ENSMUST00000135275] [ENSMUST00000177907]
AlphaFold Q01063
Predicted Effect probably benign
Transcript: ENSMUST00000074103
AA Change: M485V

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000073742
Gene: ENSMUSG00000021699
AA Change: M485V

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
HDc 329 504 1.12e-2 SMART
low complexity region 652 667 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079975
AA Change: M505V

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000078891
Gene: ENSMUSG00000021699
AA Change: M505V

DomainStartEndE-ValueType
HDc 349 524 1.12e-2 SMART
low complexity region 672 687 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117420
AA Change: M324V

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113610
Gene: ENSMUSG00000021699
AA Change: M324V

DomainStartEndE-ValueType
HDc 168 343 1.12e-2 SMART
low complexity region 491 506 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117879
AA Change: M311V

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112774
Gene: ENSMUSG00000021699
AA Change: M311V

DomainStartEndE-ValueType
HDc 155 330 1.12e-2 SMART
low complexity region 478 493 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119507
AA Change: M510V

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114089
Gene: ENSMUSG00000021699
AA Change: M510V

DomainStartEndE-ValueType
HDc 354 529 1.12e-2 SMART
low complexity region 677 692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119672
Predicted Effect probably benign
Transcript: ENSMUST00000120664
AA Change: M391V

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113024
Gene: ENSMUSG00000021699
AA Change: M391V

DomainStartEndE-ValueType
HDc 235 410 1.12e-2 SMART
low complexity region 558 573 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120671
AA Change: M610V

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112991
Gene: ENSMUSG00000021699
AA Change: M610V

DomainStartEndE-ValueType
low complexity region 45 84 N/A INTRINSIC
HDc 454 629 1.12e-2 SMART
low complexity region 777 792 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122041
AA Change: M554V

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113488
Gene: ENSMUSG00000021699
AA Change: M554V

DomainStartEndE-ValueType
HDc 398 573 1.12e-2 SMART
low complexity region 721 736 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000135275
AA Change: M507V

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119583
Gene: ENSMUSG00000021699
AA Change: M507V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
HDc 351 526 1.12e-2 SMART
low complexity region 674 689 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177907
AA Change: M554V

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000136485
Gene: ENSMUSG00000021699
AA Change: M554V

DomainStartEndE-ValueType
HDc 398 573 1.12e-2 SMART
low complexity region 721 736 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000153234
AA Change: M560V
SMART Domains Protein: ENSMUSP00000121592
Gene: ENSMUSG00000021699
AA Change: M560V

DomainStartEndE-ValueType
PDB:1E9K|A 22 59 9e-18 PDB
low complexity region 69 85 N/A INTRINSIC
HDc 405 580 1.12e-2 SMART
low complexity region 728 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155459
SMART Domains Protein: ENSMUSP00000114945
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
Pfam:PDEase_I 121 189 2.6e-23 PFAM
Meta Mutation Damage Score 0.2113 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (78/80)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit delayed growth, female infertility associated with impaired ovulation, and reduced postnatal viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 64,055,561 (GRCm39) I99N probably damaging Het
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Ankrd31 A G 13: 96,988,181 (GRCm39) I1065V possibly damaging Het
Aox1 A G 1: 58,378,831 (GRCm39) T1027A probably benign Het
Atm G A 9: 53,399,222 (GRCm39) P1593L probably benign Het
Atp13a5 T G 16: 29,167,555 (GRCm39) I132L probably benign Het
BC035044 A G 6: 128,867,852 (GRCm39) probably benign Het
Cadm3 CT C 1: 173,176,691 (GRCm39) probably benign Homo
Car3 C T 3: 14,936,677 (GRCm39) P247S probably benign Het
Ccdc7a T C 8: 129,513,819 (GRCm39) Y160C probably damaging Het
Cd1d1 A G 3: 86,905,564 (GRCm39) V143A probably benign Het
Cemip2 T A 19: 21,779,369 (GRCm39) V393E probably damaging Het
Cog6 A T 3: 52,903,473 (GRCm39) F142I probably damaging Het
Cracd A T 5: 77,005,568 (GRCm39) D643V unknown Het
Crhr1 T G 11: 104,054,682 (GRCm39) N98K possibly damaging Het
Csf1 A G 3: 107,656,479 (GRCm39) V72A probably damaging Het
Cwc15 T A 9: 14,421,537 (GRCm39) I201K probably benign Het
Dgka T C 10: 128,559,515 (GRCm39) K482R probably benign Het
Dnah7b T C 1: 46,281,476 (GRCm39) S2846P possibly damaging Het
Dst T A 1: 34,314,347 (GRCm39) I4199N probably damaging Het
Dusp7 A G 9: 106,251,095 (GRCm39) T407A possibly damaging Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Fem1a T C 17: 56,564,083 (GRCm39) Y59H possibly damaging Het
Fetub C T 16: 22,751,081 (GRCm39) R143C probably damaging Het
Filip1 A T 9: 79,723,168 (GRCm39) D1150E probably benign Het
Gabra1 A G 11: 42,031,138 (GRCm39) V264A probably damaging Het
Gm4131 T C 14: 62,702,299 (GRCm39) E223G probably damaging Het
Gon4l T C 3: 88,763,156 (GRCm39) V333A probably damaging Het
Gsk3b A G 16: 38,028,408 (GRCm39) T289A probably benign Het
Hmcn2 T C 2: 31,301,846 (GRCm39) S2912P probably damaging Het
Htr7 A T 19: 36,018,969 (GRCm39) probably benign Het
Ibsp A G 5: 104,458,167 (GRCm39) T235A probably benign Het
Ints13 A T 6: 146,467,179 (GRCm39) D116E probably damaging Het
Irag1 G T 7: 110,470,790 (GRCm39) H848N probably benign Het
Kctd19 T C 8: 106,112,117 (GRCm39) N753S probably benign Het
Mdn1 A G 4: 32,715,979 (GRCm39) N2054D probably benign Het
Mink1 A T 11: 70,502,261 (GRCm39) K880* probably null Het
Myo15b T A 11: 115,753,625 (GRCm39) L824Q possibly damaging Het
Napepld T C 5: 21,870,320 (GRCm39) E366G probably benign Het
Obscn T A 11: 58,967,819 (GRCm39) T2662S possibly damaging Het
Or2g7 T G 17: 38,378,686 (GRCm39) L208R probably damaging Het
Or2n1b T A 17: 38,459,833 (GRCm39) M118K possibly damaging Het
Or4k52 T C 2: 111,611,567 (GRCm39) F301L probably benign Het
Or52p1 A G 7: 104,267,102 (GRCm39) D72G probably damaging Het
Or5b12 A G 19: 12,896,764 (GRCm39) V303A probably benign Het
Or6d13 A G 6: 116,518,277 (GRCm39) T288A possibly damaging Het
Pah T C 10: 87,412,077 (GRCm39) probably null Het
Panx3 T G 9: 37,578,725 (GRCm39) I85L probably benign Het
Pate4 T C 9: 35,519,086 (GRCm39) N94D probably benign Het
Pik3c2b T C 1: 132,994,449 (GRCm39) S138P probably benign Het
Pkn1 T C 8: 84,398,899 (GRCm39) N696S probably damaging Het
Plppr2 A G 9: 21,855,801 (GRCm39) E258G probably damaging Het
Plxnd1 A T 6: 115,955,453 (GRCm39) M538K probably damaging Het
Prepl G T 17: 85,390,696 (GRCm39) N87K probably benign Het
Prkag2 C A 5: 25,152,534 (GRCm39) R190L probably damaging Het
Rara A G 11: 98,861,048 (GRCm39) T179A probably benign Het
Rfx7 A G 9: 72,524,279 (GRCm39) K490E possibly damaging Het
Rgsl1 C T 1: 153,703,211 (GRCm39) V147M possibly damaging Het
Rph3a A G 5: 121,083,485 (GRCm39) I595T possibly damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Homo
Slc35e2 C T 4: 155,694,483 (GRCm39) P10L probably benign Het
Slc8a2 T C 7: 15,879,259 (GRCm39) F582L possibly damaging Het
Sprr2e A G 3: 92,260,171 (GRCm39) M1V probably null Het
Steap1 T A 5: 5,790,827 (GRCm39) R40S possibly damaging Het
Tbc1d2 C T 4: 46,629,912 (GRCm39) G252R probably benign Het
Thsd7a A T 6: 12,408,835 (GRCm39) V729E probably damaging Het
Tmprss13 A G 9: 45,256,630 (GRCm39) Y525C probably damaging Het
Tnik A T 3: 28,631,649 (GRCm39) H383L possibly damaging Het
Vars1 T C 17: 35,232,719 (GRCm39) L881S probably damaging Het
Vmn1r201 A C 13: 22,659,385 (GRCm39) S200R probably damaging Het
Vmn2r130 A T 17: 23,295,759 (GRCm39) H643L probably benign Het
Vmn2r14 A T 5: 109,369,133 (GRCm39) W147R probably benign Het
Vps53 T C 11: 75,992,844 (GRCm39) E367G probably benign Het
Xab2 C T 8: 3,661,822 (GRCm39) G544S probably damaging Het
Ythdf3 T A 3: 16,259,020 (GRCm39) V400E possibly damaging Het
Zfand5 C T 19: 21,257,060 (GRCm39) P147S probably benign Het
Zfp768 A T 7: 126,944,319 (GRCm39) probably null Het
Zswim8 A G 14: 20,763,521 (GRCm39) M423V probably benign Het
Other mutations in Pde4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Pde4d APN 13 110,073,221 (GRCm39) missense possibly damaging 0.69
IGL00792:Pde4d APN 13 110,071,929 (GRCm39) missense possibly damaging 0.85
IGL01014:Pde4d APN 13 110,086,036 (GRCm39) missense probably damaging 1.00
IGL01660:Pde4d APN 13 110,074,606 (GRCm39) missense probably damaging 1.00
IGL02233:Pde4d APN 13 109,877,084 (GRCm39) missense probably damaging 1.00
IGL02405:Pde4d APN 13 108,996,743 (GRCm39) critical splice donor site probably null
IGL02544:Pde4d APN 13 109,877,057 (GRCm39) missense probably damaging 1.00
IGL02885:Pde4d APN 13 110,084,795 (GRCm39) missense probably damaging 1.00
IGL03286:Pde4d APN 13 110,091,040 (GRCm39) unclassified probably benign
IGL03406:Pde4d APN 13 110,091,125 (GRCm39) unclassified probably benign
Heliosphere UTSW 13 109,253,476 (GRCm39) missense probably benign
Stubbs UTSW 13 109,909,256 (GRCm39) intron probably benign
IGL03055:Pde4d UTSW 13 110,071,879 (GRCm39) missense probably damaging 1.00
R0020:Pde4d UTSW 13 110,091,104 (GRCm39) missense possibly damaging 0.66
R0020:Pde4d UTSW 13 110,091,104 (GRCm39) missense possibly damaging 0.66
R0054:Pde4d UTSW 13 109,876,955 (GRCm39) missense probably benign 0.23
R0054:Pde4d UTSW 13 109,876,955 (GRCm39) missense probably benign 0.23
R0357:Pde4d UTSW 13 110,087,802 (GRCm39) missense possibly damaging 0.46
R0482:Pde4d UTSW 13 110,073,244 (GRCm39) missense probably benign 0.00
R0689:Pde4d UTSW 13 109,877,078 (GRCm39) missense possibly damaging 0.78
R0884:Pde4d UTSW 13 110,087,474 (GRCm39) missense probably damaging 0.99
R1169:Pde4d UTSW 13 110,087,462 (GRCm39) splice site probably null
R1225:Pde4d UTSW 13 110,086,755 (GRCm39) missense probably benign 0.04
R1246:Pde4d UTSW 13 110,087,507 (GRCm39) missense probably damaging 1.00
R1344:Pde4d UTSW 13 110,086,921 (GRCm39) nonsense probably null
R1351:Pde4d UTSW 13 110,087,809 (GRCm39) missense possibly damaging 0.46
R1371:Pde4d UTSW 13 109,253,595 (GRCm39) missense probably benign 0.00
R1418:Pde4d UTSW 13 110,086,921 (GRCm39) nonsense probably null
R2197:Pde4d UTSW 13 110,084,924 (GRCm39) missense probably damaging 1.00
R2440:Pde4d UTSW 13 110,063,731 (GRCm39) intron probably benign
R3114:Pde4d UTSW 13 110,084,792 (GRCm39) missense probably damaging 1.00
R3115:Pde4d UTSW 13 110,084,792 (GRCm39) missense probably damaging 1.00
R3722:Pde4d UTSW 13 110,087,866 (GRCm39) nonsense probably null
R3742:Pde4d UTSW 13 109,877,013 (GRCm39) missense probably benign 0.42
R3797:Pde4d UTSW 13 109,769,431 (GRCm39) missense probably benign 0.29
R3983:Pde4d UTSW 13 109,876,940 (GRCm39) missense probably benign 0.23
R4618:Pde4d UTSW 13 110,070,411 (GRCm39) missense probably benign 0.13
R4768:Pde4d UTSW 13 110,070,408 (GRCm39) missense probably damaging 1.00
R4795:Pde4d UTSW 13 110,074,705 (GRCm39) intron probably benign
R4824:Pde4d UTSW 13 109,253,400 (GRCm39) missense probably benign 0.00
R4942:Pde4d UTSW 13 108,996,733 (GRCm39) missense probably benign 0.00
R4984:Pde4d UTSW 13 109,876,998 (GRCm39) missense probably damaging 1.00
R5180:Pde4d UTSW 13 109,877,007 (GRCm39) missense probably benign 0.13
R5267:Pde4d UTSW 13 109,397,343 (GRCm39) intron probably benign
R5311:Pde4d UTSW 13 109,769,399 (GRCm39) missense probably benign
R5311:Pde4d UTSW 13 109,769,398 (GRCm39) missense probably benign 0.02
R5376:Pde4d UTSW 13 109,909,178 (GRCm39) missense probably benign 0.00
R5551:Pde4d UTSW 13 110,084,930 (GRCm39) critical splice donor site probably null
R5753:Pde4d UTSW 13 109,909,256 (GRCm39) intron probably benign
R5754:Pde4d UTSW 13 110,074,547 (GRCm39) missense probably damaging 0.98
R5838:Pde4d UTSW 13 109,876,976 (GRCm39) missense probably damaging 0.99
R5864:Pde4d UTSW 13 110,074,582 (GRCm39) missense probably benign 0.00
R6039:Pde4d UTSW 13 110,084,876 (GRCm39) missense probably damaging 1.00
R6039:Pde4d UTSW 13 110,084,876 (GRCm39) missense probably damaging 1.00
R6049:Pde4d UTSW 13 109,169,119 (GRCm39) nonsense probably null
R6214:Pde4d UTSW 13 110,085,967 (GRCm39) missense probably damaging 1.00
R6215:Pde4d UTSW 13 110,085,967 (GRCm39) missense probably damaging 1.00
R6431:Pde4d UTSW 13 109,738,320 (GRCm39) splice site probably null
R6501:Pde4d UTSW 13 109,253,476 (GRCm39) missense probably benign
R6534:Pde4d UTSW 13 109,769,435 (GRCm39) missense probably benign 0.05
R6709:Pde4d UTSW 13 110,084,813 (GRCm39) missense probably damaging 1.00
R6722:Pde4d UTSW 13 109,769,432 (GRCm39) nonsense probably null
R7164:Pde4d UTSW 13 109,169,222 (GRCm39) missense probably benign
R7222:Pde4d UTSW 13 109,894,113 (GRCm39) missense probably damaging 1.00
R7417:Pde4d UTSW 13 109,769,322 (GRCm39) splice site probably null
R7489:Pde4d UTSW 13 109,253,301 (GRCm39) missense unknown
R7563:Pde4d UTSW 13 110,087,541 (GRCm39) missense probably benign 0.37
R7861:Pde4d UTSW 13 110,071,858 (GRCm39) missense probably damaging 0.99
R8167:Pde4d UTSW 13 109,578,855 (GRCm39) missense probably benign 0.00
R8197:Pde4d UTSW 13 110,084,870 (GRCm39) missense probably damaging 1.00
R8469:Pde4d UTSW 13 108,996,722 (GRCm39) missense probably benign
R8715:Pde4d UTSW 13 110,071,876 (GRCm39) missense probably benign 0.29
R8926:Pde4d UTSW 13 110,074,625 (GRCm39) missense probably benign 0.00
R9054:Pde4d UTSW 13 110,071,924 (GRCm39) missense probably damaging 0.96
R9406:Pde4d UTSW 13 109,877,064 (GRCm39) missense probably damaging 0.99
R9516:Pde4d UTSW 13 109,397,196 (GRCm39) missense
R9526:Pde4d UTSW 13 110,071,915 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGTGCCTCTCAAGACAG -3'
(R):5'- AACCAACCAATACTGTGAGGTAG -3'

Sequencing Primer
(F):5'- GTGCCTCTCAAGACAGTTAAATGCAG -3'
(R):5'- CCAAGTGCTTCAGCGGTG -3'
Posted On 2018-03-15