Mutagenetix > Incidental Mutation

Incidental Mutation 'R6273:Zswim8'

507490

Institutional Source

Beutler Lab

Gene Symbol

Zswim8

Ensembl Gene

ENSMUSG00000021819

Gene Name

zinc finger SWIM-type containing 8

Synonyms

2310021P13Rik, 4832404P21Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R6273 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20707552-20723619 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20713453 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 423 (M423V)

Ref Sequence

ENSEMBL: ENSMUSP00000153285 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022358] [ENSMUST00000223840] [ENSMUST00000224129] [ENSMUST00000224751]

AlphaFold

Q3UHH1

Predicted Effect

probably benign
Transcript: ENSMUST00000022358
AA Change: M423V

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000022358
Gene: ENSMUSG00000021819
AA Change: M423V

Domain	Start	End	E-Value	Type
low complexity region	50	66	N/A	INTRINSIC
low complexity region	89	102	N/A	INTRINSIC
low complexity region	390	405	N/A	INTRINSIC
low complexity region	578	612	N/A	INTRINSIC
low complexity region	736	751	N/A	INTRINSIC
low complexity region	1000	1015	N/A	INTRINSIC
low complexity region	1120	1135	N/A	INTRINSIC
low complexity region	1176	1211	N/A	INTRINSIC
low complexity region	1259	1270	N/A	INTRINSIC
low complexity region	1343	1355	N/A	INTRINSIC
low complexity region	1470	1487	N/A	INTRINSIC
low complexity region	1491	1511	N/A	INTRINSIC
low complexity region	1527	1542	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223782

Predicted Effect

probably benign
Transcript: ENSMUST00000223840
AA Change: M423V

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

probably benign
Transcript: ENSMUST00000224129

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224165

Predicted Effect

probably benign
Transcript: ENSMUST00000224751
AA Change: M423V

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225010

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225332

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225715

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225743

Meta Mutation Damage Score

0.0776

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

98% (78/80)

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,218	I99N	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ankrd31	A	G	13: 96,851,673	I1065V	possibly damaging	Het
Aox2	A	G	1: 58,339,672	T1027A	probably benign	Het
Atm	G	A	9: 53,487,922	P1593L	probably benign	Het
Atp13a5	T	G	16: 29,348,737	I132L	probably benign	Het
BC035044	A	G	6: 128,890,889		probably benign	Het
C530008M17Rik	A	T	5: 76,857,721	D643V	unknown	Het
Cadm3	CT	C	1: 173,349,124		probably benign	Homo
Car3	C	T	3: 14,871,617	P247S	probably benign	Het
Ccdc7a	T	C	8: 128,787,338	Y160C	probably damaging	Het
Cd1d1	A	G	3: 86,998,257	V143A	probably benign	Het
Cog6	A	T	3: 52,996,052	F142I	probably damaging	Het
Crhr1	T	G	11: 104,163,856	N98K	possibly damaging	Het
Csf1	A	G	3: 107,749,163	V72A	probably damaging	Het
Cwc15	T	A	9: 14,510,241	I201K	probably benign	Het
Dgka	T	C	10: 128,723,646	K482R	probably benign	Het
Dnah7b	T	C	1: 46,242,316	S2846P	possibly damaging	Het
Dst	T	A	1: 34,275,266	I4199N	probably damaging	Het
Dusp7	A	G	9: 106,373,896	T407A	possibly damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fem1a	T	C	17: 56,257,083	Y59H	possibly damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Filip1	A	T	9: 79,815,886	D1150E	probably benign	Het
Gabra1	A	G	11: 42,140,311	V264A	probably damaging	Het
Gm4131	T	C	14: 62,464,850	E223G	probably damaging	Het
Gon4l	T	C	3: 88,855,849	V333A	probably damaging	Het
Gsk3b	A	G	16: 38,208,046	T289A	probably benign	Het
Hmcn2	T	C	2: 31,411,834	S2912P	probably damaging	Het
Htr7	A	T	19: 36,041,569		probably benign	Het
Ibsp	A	G	5: 104,310,301	T235A	probably benign	Het
Ints13	A	T	6: 146,565,681	D116E	probably damaging	Het
Kctd19	T	C	8: 105,385,485	N753S	probably benign	Het
Mdn1	A	G	4: 32,715,979	N2054D	probably benign	Het
Mink1	A	T	11: 70,611,435	K880*	probably null	Het
Mrvi1	G	T	7: 110,871,583	H848N	probably benign	Het
Myo15b	T	A	11: 115,862,799	L824Q	possibly damaging	Het
Napepld	T	C	5: 21,665,322	E366G	probably benign	Het
Obscn	T	A	11: 59,076,993	T2662S	possibly damaging	Het
Olfr130	T	G	17: 38,067,795	L208R	probably damaging	Het
Olfr1302	T	C	2: 111,781,222	F301L	probably benign	Het
Olfr133	T	A	17: 38,148,942	M118K	possibly damaging	Het
Olfr1448	A	G	19: 12,919,400	V303A	probably benign	Het
Olfr213	A	G	6: 116,541,316	T288A	possibly damaging	Het
Olfr656	A	G	7: 104,617,895	D72G	probably damaging	Het
Pah	T	C	10: 87,576,215		probably null	Het
Panx3	T	G	9: 37,667,429	I85L	probably benign	Het
Pate4	T	C	9: 35,607,790	N94D	probably benign	Het
Pde4d	A	G	13: 109,950,221	M610V	possibly damaging	Het
Pik3c2b	T	C	1: 133,066,711	S138P	probably benign	Het
Pkn1	T	C	8: 83,672,270	N696S	probably damaging	Het
Plppr2	A	G	9: 21,944,505	E258G	probably damaging	Het
Plxnd1	A	T	6: 115,978,492	M538K	probably damaging	Het
Prepl	G	T	17: 85,083,268	N87K	probably benign	Het
Prkag2	C	A	5: 24,947,536	R190L	probably damaging	Het
Rara	A	G	11: 98,970,222	T179A	probably benign	Het
Rfx7	A	G	9: 72,616,997	K490E	possibly damaging	Het
Rgsl1	C	T	1: 153,827,465	V147M	possibly damaging	Het
Rph3a	A	G	5: 120,945,422	I595T	possibly damaging	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Homo
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Slc8a2	T	C	7: 16,145,334	F582L	possibly damaging	Het
Sprr2e	A	G	3: 92,352,864	M1V	probably null	Het
Steap1	T	A	5: 5,740,827	R40S	possibly damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Thsd7a	A	T	6: 12,408,836	V729E	probably damaging	Het
Tmem2	T	A	19: 21,802,005	V393E	probably damaging	Het
Tmprss13	A	G	9: 45,345,332	Y525C	probably damaging	Het
Tnik	A	T	3: 28,577,500	H383L	possibly damaging	Het
Vars	T	C	17: 35,013,743	L881S	probably damaging	Het
Vmn1r201	A	C	13: 22,475,215	S200R	probably damaging	Het
Vmn2r14	A	T	5: 109,221,267	W147R	probably benign	Het
Vmn2r-ps130	A	T	17: 23,076,785	H643L	probably benign	Het
Vps53	T	C	11: 76,102,018	E367G	probably benign	Het
Xab2	C	T	8: 3,611,822	G544S	probably damaging	Het
Ythdf3	T	A	3: 16,204,856	V400E	possibly damaging	Het
Zfand5	C	T	19: 21,279,696	P147S	probably benign	Het
Zfp768	A	T	7: 127,345,147		probably null	Het

Other mutations in Zswim8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Zswim8	APN	14	20718475	missense	probably damaging	0.99
IGL00470:Zswim8	APN	14	20723181	missense	probably damaging	1.00
IGL00675:Zswim8	APN	14	20716901	unclassified	probably benign
IGL00896:Zswim8	APN	14	20716001	missense	probably damaging	1.00
IGL01343:Zswim8	APN	14	20713341	missense	probably damaging	1.00
IGL01736:Zswim8	APN	14	20714712	missense	probably benign	0.11
IGL01961:Zswim8	APN	14	20712334	missense	possibly damaging	0.76
IGL02331:Zswim8	APN	14	20723257	missense	probably damaging	1.00
IGL02485:Zswim8	APN	14	20711887	missense	probably damaging	0.98
IGL02662:Zswim8	APN	14	20713074	missense	probably benign	0.14
IGL03001:Zswim8	APN	14	20714391	missense	probably damaging	1.00
pool	UTSW	14	20714573	splice site	probably null
R0123:Zswim8	UTSW	14	20716490	splice site	probably benign
R0362:Zswim8	UTSW	14	20721945	missense	possibly damaging	0.58
R0402:Zswim8	UTSW	14	20710766	missense	probably damaging	1.00
R0458:Zswim8	UTSW	14	20718897	missense	probably damaging	1.00
R1087:Zswim8	UTSW	14	20717865	splice site	probably null
R1158:Zswim8	UTSW	14	20721668	splice site	probably benign
R1171:Zswim8	UTSW	14	20713113	missense	possibly damaging	0.94
R1389:Zswim8	UTSW	14	20710748	missense	probably damaging	1.00
R1773:Zswim8	UTSW	14	20711530	missense	probably damaging	0.96
R1780:Zswim8	UTSW	14	20716327	missense	probably damaging	0.99
R1850:Zswim8	UTSW	14	20710747	nonsense	probably null
R2421:Zswim8	UTSW	14	20719457	missense	probably damaging	1.00
R3826:Zswim8	UTSW	14	20711089	nonsense	probably null
R3965:Zswim8	UTSW	14	20713073	missense	probably benign
R4301:Zswim8	UTSW	14	20713909	missense	possibly damaging	0.91
R4499:Zswim8	UTSW	14	20714297	missense	probably benign	0.05
R4633:Zswim8	UTSW	14	20718823	missense	probably damaging	1.00
R4675:Zswim8	UTSW	14	20714613	missense	probably benign
R4958:Zswim8	UTSW	14	20713465	missense	probably damaging	1.00
R5255:Zswim8	UTSW	14	20721651	missense	probably damaging	1.00
R5288:Zswim8	UTSW	14	20718871	missense	possibly damaging	0.92
R5341:Zswim8	UTSW	14	20716054	missense	probably damaging	1.00
R5495:Zswim8	UTSW	14	20722286	missense	probably damaging	0.97
R5652:Zswim8	UTSW	14	20713427	missense	possibly damaging	0.62
R6281:Zswim8	UTSW	14	20714640	missense	probably benign	0.02
R6364:Zswim8	UTSW	14	20713011	missense	probably damaging	1.00
R6426:Zswim8	UTSW	14	20718526	missense	probably damaging	0.99
R6576:Zswim8	UTSW	14	20721874	missense	probably benign	0.41
R6798:Zswim8	UTSW	14	20715992	missense	probably damaging	1.00
R7059:Zswim8	UTSW	14	20714573	splice site	probably null
R7243:Zswim8	UTSW	14	20714368	missense	probably damaging	1.00
R7250:Zswim8	UTSW	14	20719968	missense	probably damaging	1.00
R7311:Zswim8	UTSW	14	20721484	missense	probably damaging	1.00
R7567:Zswim8	UTSW	14	20719933	missense	probably damaging	1.00
R7635:Zswim8	UTSW	14	20716300	missense	probably damaging	0.99
R7771:Zswim8	UTSW	14	20712980	missense	probably damaging	1.00
R7874:Zswim8	UTSW	14	20723149	missense	probably damaging	0.98
R7994:Zswim8	UTSW	14	20708004	missense	possibly damaging	0.95
R8466:Zswim8	UTSW	14	20710676	missense	possibly damaging	0.93
R9019:Zswim8	UTSW	14	20711051	missense	probably damaging	1.00
R9177:Zswim8	UTSW	14	20711840	missense	probably damaging	1.00
R9192:Zswim8	UTSW	14	20719520	missense	probably damaging	1.00
R9229:Zswim8	UTSW	14	20716325	missense	probably benign	0.45
R9268:Zswim8	UTSW	14	20711840	missense	probably damaging	1.00
R9562:Zswim8	UTSW	14	20712082	nonsense	probably null
R9589:Zswim8	UTSW	14	20713103	missense	probably damaging	0.99
R9621:Zswim8	UTSW	14	20722163	missense	probably benign	0.00
X0026:Zswim8	UTSW	14	20710632	splice site	probably null
X0028:Zswim8	UTSW	14	20714657	missense	probably benign	0.19
X0058:Zswim8	UTSW	14	20712990	missense	probably damaging	0.99
Z1177:Zswim8	UTSW	14	20713044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGCCTCACCTATGAACAGG -3'
(R):5'- TAGTCACCTCAGTGCTCAGC -3'

Sequencing Primer
(F):5'- TTTATTCTGACAGGAACATAGAGGAG -3'
(R):5'- CACTTCCCATTCCCCTAGGTGAG -3'

Posted On

2018-03-15