Incidental Mutation 'R6273:Zswim8'
ID 507490
Institutional Source Beutler Lab
Gene Symbol Zswim8
Ensembl Gene ENSMUSG00000021819
Gene Name zinc finger SWIM-type containing 8
Synonyms 2310021P13Rik, 4832404P21Rik
MMRRC Submission 044443-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.965) question?
Stock # R6273 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 20757620-20773687 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20763521 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 423 (M423V)
Ref Sequence ENSEMBL: ENSMUSP00000153285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022358] [ENSMUST00000223840] [ENSMUST00000224129] [ENSMUST00000224751]
AlphaFold Q3UHH1
Predicted Effect probably benign
Transcript: ENSMUST00000022358
AA Change: M423V

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000022358
Gene: ENSMUSG00000021819
AA Change: M423V

DomainStartEndE-ValueType
low complexity region 50 66 N/A INTRINSIC
low complexity region 89 102 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
low complexity region 578 612 N/A INTRINSIC
low complexity region 736 751 N/A INTRINSIC
low complexity region 1000 1015 N/A INTRINSIC
low complexity region 1120 1135 N/A INTRINSIC
low complexity region 1176 1211 N/A INTRINSIC
low complexity region 1259 1270 N/A INTRINSIC
low complexity region 1343 1355 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1491 1511 N/A INTRINSIC
low complexity region 1527 1542 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223782
Predicted Effect probably benign
Transcript: ENSMUST00000223840
AA Change: M423V

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000224129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224165
Predicted Effect probably benign
Transcript: ENSMUST00000224751
AA Change: M423V

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225743
Meta Mutation Damage Score 0.0776 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (78/80)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 64,055,561 (GRCm39) I99N probably damaging Het
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Ankrd31 A G 13: 96,988,181 (GRCm39) I1065V possibly damaging Het
Aox1 A G 1: 58,378,831 (GRCm39) T1027A probably benign Het
Atm G A 9: 53,399,222 (GRCm39) P1593L probably benign Het
Atp13a5 T G 16: 29,167,555 (GRCm39) I132L probably benign Het
BC035044 A G 6: 128,867,852 (GRCm39) probably benign Het
Cadm3 CT C 1: 173,176,691 (GRCm39) probably benign Homo
Car3 C T 3: 14,936,677 (GRCm39) P247S probably benign Het
Ccdc7a T C 8: 129,513,819 (GRCm39) Y160C probably damaging Het
Cd1d1 A G 3: 86,905,564 (GRCm39) V143A probably benign Het
Cemip2 T A 19: 21,779,369 (GRCm39) V393E probably damaging Het
Cog6 A T 3: 52,903,473 (GRCm39) F142I probably damaging Het
Cracd A T 5: 77,005,568 (GRCm39) D643V unknown Het
Crhr1 T G 11: 104,054,682 (GRCm39) N98K possibly damaging Het
Csf1 A G 3: 107,656,479 (GRCm39) V72A probably damaging Het
Cwc15 T A 9: 14,421,537 (GRCm39) I201K probably benign Het
Dgka T C 10: 128,559,515 (GRCm39) K482R probably benign Het
Dnah7b T C 1: 46,281,476 (GRCm39) S2846P possibly damaging Het
Dst T A 1: 34,314,347 (GRCm39) I4199N probably damaging Het
Dusp7 A G 9: 106,251,095 (GRCm39) T407A possibly damaging Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Fem1a T C 17: 56,564,083 (GRCm39) Y59H possibly damaging Het
Fetub C T 16: 22,751,081 (GRCm39) R143C probably damaging Het
Filip1 A T 9: 79,723,168 (GRCm39) D1150E probably benign Het
Gabra1 A G 11: 42,031,138 (GRCm39) V264A probably damaging Het
Gm4131 T C 14: 62,702,299 (GRCm39) E223G probably damaging Het
Gon4l T C 3: 88,763,156 (GRCm39) V333A probably damaging Het
Gsk3b A G 16: 38,028,408 (GRCm39) T289A probably benign Het
Hmcn2 T C 2: 31,301,846 (GRCm39) S2912P probably damaging Het
Htr7 A T 19: 36,018,969 (GRCm39) probably benign Het
Ibsp A G 5: 104,458,167 (GRCm39) T235A probably benign Het
Ints13 A T 6: 146,467,179 (GRCm39) D116E probably damaging Het
Irag1 G T 7: 110,470,790 (GRCm39) H848N probably benign Het
Kctd19 T C 8: 106,112,117 (GRCm39) N753S probably benign Het
Mdn1 A G 4: 32,715,979 (GRCm39) N2054D probably benign Het
Mink1 A T 11: 70,502,261 (GRCm39) K880* probably null Het
Myo15b T A 11: 115,753,625 (GRCm39) L824Q possibly damaging Het
Napepld T C 5: 21,870,320 (GRCm39) E366G probably benign Het
Obscn T A 11: 58,967,819 (GRCm39) T2662S possibly damaging Het
Or2g7 T G 17: 38,378,686 (GRCm39) L208R probably damaging Het
Or2n1b T A 17: 38,459,833 (GRCm39) M118K possibly damaging Het
Or4k52 T C 2: 111,611,567 (GRCm39) F301L probably benign Het
Or52p1 A G 7: 104,267,102 (GRCm39) D72G probably damaging Het
Or5b12 A G 19: 12,896,764 (GRCm39) V303A probably benign Het
Or6d13 A G 6: 116,518,277 (GRCm39) T288A possibly damaging Het
Pah T C 10: 87,412,077 (GRCm39) probably null Het
Panx3 T G 9: 37,578,725 (GRCm39) I85L probably benign Het
Pate4 T C 9: 35,519,086 (GRCm39) N94D probably benign Het
Pde4d A G 13: 110,086,755 (GRCm39) M610V possibly damaging Het
Pik3c2b T C 1: 132,994,449 (GRCm39) S138P probably benign Het
Pkn1 T C 8: 84,398,899 (GRCm39) N696S probably damaging Het
Plppr2 A G 9: 21,855,801 (GRCm39) E258G probably damaging Het
Plxnd1 A T 6: 115,955,453 (GRCm39) M538K probably damaging Het
Prepl G T 17: 85,390,696 (GRCm39) N87K probably benign Het
Prkag2 C A 5: 25,152,534 (GRCm39) R190L probably damaging Het
Rara A G 11: 98,861,048 (GRCm39) T179A probably benign Het
Rfx7 A G 9: 72,524,279 (GRCm39) K490E possibly damaging Het
Rgsl1 C T 1: 153,703,211 (GRCm39) V147M possibly damaging Het
Rph3a A G 5: 121,083,485 (GRCm39) I595T possibly damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Homo
Slc35e2 C T 4: 155,694,483 (GRCm39) P10L probably benign Het
Slc8a2 T C 7: 15,879,259 (GRCm39) F582L possibly damaging Het
Sprr2e A G 3: 92,260,171 (GRCm39) M1V probably null Het
Steap1 T A 5: 5,790,827 (GRCm39) R40S possibly damaging Het
Tbc1d2 C T 4: 46,629,912 (GRCm39) G252R probably benign Het
Thsd7a A T 6: 12,408,835 (GRCm39) V729E probably damaging Het
Tmprss13 A G 9: 45,256,630 (GRCm39) Y525C probably damaging Het
Tnik A T 3: 28,631,649 (GRCm39) H383L possibly damaging Het
Vars1 T C 17: 35,232,719 (GRCm39) L881S probably damaging Het
Vmn1r201 A C 13: 22,659,385 (GRCm39) S200R probably damaging Het
Vmn2r130 A T 17: 23,295,759 (GRCm39) H643L probably benign Het
Vmn2r14 A T 5: 109,369,133 (GRCm39) W147R probably benign Het
Vps53 T C 11: 75,992,844 (GRCm39) E367G probably benign Het
Xab2 C T 8: 3,661,822 (GRCm39) G544S probably damaging Het
Ythdf3 T A 3: 16,259,020 (GRCm39) V400E possibly damaging Het
Zfand5 C T 19: 21,257,060 (GRCm39) P147S probably benign Het
Zfp768 A T 7: 126,944,319 (GRCm39) probably null Het
Other mutations in Zswim8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Zswim8 APN 14 20,768,543 (GRCm39) missense probably damaging 0.99
IGL00470:Zswim8 APN 14 20,773,249 (GRCm39) missense probably damaging 1.00
IGL00675:Zswim8 APN 14 20,766,969 (GRCm39) unclassified probably benign
IGL00896:Zswim8 APN 14 20,766,069 (GRCm39) missense probably damaging 1.00
IGL01343:Zswim8 APN 14 20,763,409 (GRCm39) missense probably damaging 1.00
IGL01736:Zswim8 APN 14 20,764,780 (GRCm39) missense probably benign 0.11
IGL01961:Zswim8 APN 14 20,762,402 (GRCm39) missense possibly damaging 0.76
IGL02331:Zswim8 APN 14 20,773,325 (GRCm39) missense probably damaging 1.00
IGL02485:Zswim8 APN 14 20,761,955 (GRCm39) missense probably damaging 0.98
IGL02662:Zswim8 APN 14 20,763,142 (GRCm39) missense probably benign 0.14
IGL03001:Zswim8 APN 14 20,764,459 (GRCm39) missense probably damaging 1.00
pool UTSW 14 20,764,641 (GRCm39) splice site probably null
R0123:Zswim8 UTSW 14 20,766,558 (GRCm39) splice site probably benign
R0362:Zswim8 UTSW 14 20,772,013 (GRCm39) missense possibly damaging 0.58
R0402:Zswim8 UTSW 14 20,760,834 (GRCm39) missense probably damaging 1.00
R0458:Zswim8 UTSW 14 20,768,965 (GRCm39) missense probably damaging 1.00
R1087:Zswim8 UTSW 14 20,767,933 (GRCm39) splice site probably null
R1158:Zswim8 UTSW 14 20,771,736 (GRCm39) splice site probably benign
R1171:Zswim8 UTSW 14 20,763,181 (GRCm39) missense possibly damaging 0.94
R1389:Zswim8 UTSW 14 20,760,816 (GRCm39) missense probably damaging 1.00
R1773:Zswim8 UTSW 14 20,761,598 (GRCm39) missense probably damaging 0.96
R1780:Zswim8 UTSW 14 20,766,395 (GRCm39) missense probably damaging 0.99
R1850:Zswim8 UTSW 14 20,760,815 (GRCm39) nonsense probably null
R2421:Zswim8 UTSW 14 20,769,525 (GRCm39) missense probably damaging 1.00
R3826:Zswim8 UTSW 14 20,761,157 (GRCm39) nonsense probably null
R3965:Zswim8 UTSW 14 20,763,141 (GRCm39) missense probably benign
R4301:Zswim8 UTSW 14 20,763,977 (GRCm39) missense possibly damaging 0.91
R4499:Zswim8 UTSW 14 20,764,365 (GRCm39) missense probably benign 0.05
R4633:Zswim8 UTSW 14 20,768,891 (GRCm39) missense probably damaging 1.00
R4675:Zswim8 UTSW 14 20,764,681 (GRCm39) missense probably benign
R4958:Zswim8 UTSW 14 20,763,533 (GRCm39) missense probably damaging 1.00
R5255:Zswim8 UTSW 14 20,771,719 (GRCm39) missense probably damaging 1.00
R5288:Zswim8 UTSW 14 20,768,939 (GRCm39) missense possibly damaging 0.92
R5341:Zswim8 UTSW 14 20,766,122 (GRCm39) missense probably damaging 1.00
R5495:Zswim8 UTSW 14 20,772,354 (GRCm39) missense probably damaging 0.97
R5652:Zswim8 UTSW 14 20,763,495 (GRCm39) missense possibly damaging 0.62
R6281:Zswim8 UTSW 14 20,764,708 (GRCm39) missense probably benign 0.02
R6364:Zswim8 UTSW 14 20,763,079 (GRCm39) missense probably damaging 1.00
R6426:Zswim8 UTSW 14 20,768,594 (GRCm39) missense probably damaging 0.99
R6576:Zswim8 UTSW 14 20,771,942 (GRCm39) missense probably benign 0.41
R6798:Zswim8 UTSW 14 20,766,060 (GRCm39) missense probably damaging 1.00
R7059:Zswim8 UTSW 14 20,764,641 (GRCm39) splice site probably null
R7243:Zswim8 UTSW 14 20,764,436 (GRCm39) missense probably damaging 1.00
R7250:Zswim8 UTSW 14 20,770,036 (GRCm39) missense probably damaging 1.00
R7311:Zswim8 UTSW 14 20,771,552 (GRCm39) missense probably damaging 1.00
R7567:Zswim8 UTSW 14 20,770,001 (GRCm39) missense probably damaging 1.00
R7635:Zswim8 UTSW 14 20,766,368 (GRCm39) missense probably damaging 0.99
R7771:Zswim8 UTSW 14 20,763,048 (GRCm39) missense probably damaging 1.00
R7874:Zswim8 UTSW 14 20,773,217 (GRCm39) missense probably damaging 0.98
R7994:Zswim8 UTSW 14 20,758,072 (GRCm39) missense possibly damaging 0.95
R8466:Zswim8 UTSW 14 20,760,744 (GRCm39) missense possibly damaging 0.93
R9019:Zswim8 UTSW 14 20,761,119 (GRCm39) missense probably damaging 1.00
R9177:Zswim8 UTSW 14 20,761,908 (GRCm39) missense probably damaging 1.00
R9192:Zswim8 UTSW 14 20,769,588 (GRCm39) missense probably damaging 1.00
R9229:Zswim8 UTSW 14 20,766,393 (GRCm39) missense probably benign 0.45
R9268:Zswim8 UTSW 14 20,761,908 (GRCm39) missense probably damaging 1.00
R9562:Zswim8 UTSW 14 20,762,150 (GRCm39) nonsense probably null
R9589:Zswim8 UTSW 14 20,763,171 (GRCm39) missense probably damaging 0.99
R9621:Zswim8 UTSW 14 20,772,231 (GRCm39) missense probably benign 0.00
X0026:Zswim8 UTSW 14 20,760,700 (GRCm39) splice site probably null
X0028:Zswim8 UTSW 14 20,764,725 (GRCm39) missense probably benign 0.19
X0058:Zswim8 UTSW 14 20,763,058 (GRCm39) missense probably damaging 0.99
Z1177:Zswim8 UTSW 14 20,763,112 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCCTCACCTATGAACAGG -3'
(R):5'- TAGTCACCTCAGTGCTCAGC -3'

Sequencing Primer
(F):5'- TTTATTCTGACAGGAACATAGAGGAG -3'
(R):5'- CACTTCCCATTCCCCTAGGTGAG -3'
Posted On 2018-03-15