Incidental Mutation 'R6274:Kif21b'
ID 507506
Institutional Source Beutler Lab
Gene Symbol Kif21b
Ensembl Gene ENSMUSG00000041642
Gene Name kinesin family member 21B
Synonyms 2610511N21Rik, N-5 kinesin
MMRRC Submission 044444-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.157) question?
Stock # R6274 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 136059127-136105736 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 136077156 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 393 (I393V)
Ref Sequence ENSEMBL: ENSMUSP00000114297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075164] [ENSMUST00000130864]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000075164
AA Change: I393V

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642
AA Change: I393V

DomainStartEndE-ValueType
KISc 6 379 6.39e-159 SMART
Blast:KISc 469 543 1e-14 BLAST
low complexity region 578 628 N/A INTRINSIC
coiled coil region 632 825 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
coiled coil region 931 991 N/A INTRINSIC
low complexity region 1109 1123 N/A INTRINSIC
low complexity region 1239 1249 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
WD40 1299 1336 2.89e-5 SMART
WD40 1339 1377 5.69e-4 SMART
WD40 1404 1441 6.42e-1 SMART
WD40 1444 1486 1.5e-3 SMART
WD40 1494 1532 4.8e-2 SMART
WD40 1535 1575 1.55e-5 SMART
WD40 1578 1615 3.81e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122892
Predicted Effect possibly damaging
Transcript: ENSMUST00000130864
AA Change: I393V

PolyPhen 2 Score 0.570 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114297
Gene: ENSMUSG00000041642
AA Change: I393V

DomainStartEndE-ValueType
KISc 6 379 6.39e-159 SMART
Blast:KISc 469 543 1e-14 BLAST
low complexity region 578 628 N/A INTRINSIC
coiled coil region 632 825 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
coiled coil region 931 991 N/A INTRINSIC
low complexity region 1109 1123 N/A INTRINSIC
low complexity region 1239 1249 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
WD40 1299 1336 2.89e-5 SMART
WD40 1339 1377 5.69e-4 SMART
WD40 1404 1441 6.42e-1 SMART
WD40 1444 1486 1.5e-3 SMART
WD40 1494 1532 4.8e-2 SMART
WD40 1535 1575 1.55e-5 SMART
WD40 1578 1615 5.1e-6 SMART
Meta Mutation Damage Score 0.1013 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily. Kinesins are ATP-dependent microtubule-based motor proteins that are involved in the intracellular transport of membranous organelles. Single nucleotide polymorphisms in this gene are associated with inflammatory bowel disease and multiple sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous KO reduces dendrite branching and spine density as a result of reduced microtubule growth, resulting in impaired spatial learning and cued conditioning behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Ano1 A T 7: 144,172,600 (GRCm39) S528T probably benign Het
Araf G T X: 20,726,339 (GRCm39) R601L probably damaging Homo
Bcl2l10 T C 9: 75,258,354 (GRCm39) I172T possibly damaging Het
Bpifb3 A T 2: 153,771,243 (GRCm39) N385I possibly damaging Het
Bsnd A G 4: 106,343,832 (GRCm39) V158A probably damaging Het
Cacna1s A G 1: 136,016,783 (GRCm39) N481S probably benign Het
Cdk5rap1 A G 2: 154,210,161 (GRCm39) V138A probably damaging Het
Cep290 A G 10: 100,366,069 (GRCm39) E1099G probably damaging Het
Cers1 T A 8: 70,783,727 (GRCm39) L225Q probably damaging Het
Cfb T C 17: 35,081,069 (GRCm39) Q7R probably benign Het
Clk4 A G 11: 51,162,748 (GRCm39) S98G possibly damaging Het
Clock A G 5: 76,385,000 (GRCm39) S406P probably benign Het
Csmd3 T C 15: 47,484,833 (GRCm39) I3178V probably benign Het
Dock10 A G 1: 80,516,540 (GRCm39) S1397P probably damaging Het
Fer1l4 A G 2: 155,871,188 (GRCm39) L1421P probably damaging Het
Fetub C T 16: 22,751,081 (GRCm39) R143C probably damaging Het
Greb1 G T 12: 16,785,152 (GRCm39) T91K probably damaging Het
Grid2ip G A 5: 143,366,184 (GRCm39) S379N probably damaging Het
Gucy1b2 A T 14: 62,653,388 (GRCm39) C336S probably damaging Het
Hdac1 A G 4: 129,412,902 (GRCm39) C261R probably damaging Het
Htt T C 5: 35,009,431 (GRCm39) S1471P possibly damaging Het
Ice1 A G 13: 70,742,958 (GRCm39) V2134A probably damaging Het
Ikzf1 C T 11: 11,718,961 (GRCm39) Q310* probably null Het
Il3ra G A 14: 14,350,180 (GRCm38) V112I probably benign Het
Krt74 T C 15: 101,671,872 (GRCm39) noncoding transcript Het
Krtap29-1 T C 11: 99,869,809 (GRCm39) N24S probably null Het
Mmut T C 17: 41,267,136 (GRCm39) V570A probably benign Het
Myh7 T C 14: 55,216,943 (GRCm39) D1138G probably damaging Het
Nktr T C 9: 121,560,631 (GRCm39) I125T probably damaging Het
Nlrp2 A T 7: 5,320,554 (GRCm39) L861Q probably damaging Het
Notch3 C A 17: 32,366,264 (GRCm39) R990L probably benign Het
Nrap T C 19: 56,350,153 (GRCm39) D655G probably benign Het
Or10ak8 A T 4: 118,774,427 (GRCm39) V79E probably benign Het
Or5b99 G A 19: 12,977,234 (GRCm39) V295I probably damaging Het
Osbpl11 T A 16: 33,047,426 (GRCm39) I463N probably damaging Het
Pcsk6 A T 7: 65,683,592 (GRCm39) R749W probably damaging Het
Plaat5 C T 19: 7,614,831 (GRCm39) T231I probably damaging Het
Plxnb1 T C 9: 108,941,209 (GRCm39) probably null Het
Polr1a T A 6: 71,931,874 (GRCm39) probably null Het
Ppm1g T C 5: 31,363,750 (GRCm39) I153V probably damaging Het
Ppp1r12a T C 10: 108,096,751 (GRCm39) S191P probably benign Het
Prodh T C 16: 17,898,922 (GRCm39) K178E possibly damaging Het
Rilpl2 A G 5: 124,607,911 (GRCm39) V103A possibly damaging Het
Sap18b C T 8: 96,552,169 (GRCm39) H60Y probably benign Het
Sclt1 A G 3: 41,583,951 (GRCm39) probably null Het
Serpinb1a G T 13: 33,026,849 (GRCm39) H364Q probably damaging Het
Sez6l G A 5: 112,623,231 (GRCm39) Q107* probably null Het
Sipa1l2 C T 8: 126,196,611 (GRCm39) V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 (GRCm39) G252R probably benign Het
Uaca T A 9: 60,757,573 (GRCm39) probably null Het
Uqcrc1 C A 9: 108,771,224 (GRCm39) H95N probably damaging Het
Usp9y C T Y: 1,316,735 (GRCm39) R1938H probably damaging Homo
Wnk4 C T 11: 101,156,257 (GRCm39) R42W probably damaging Het
Zfp326 T A 5: 106,053,846 (GRCm39) L242Q probably damaging Het
Other mutations in Kif21b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Kif21b APN 1 136,080,080 (GRCm39) missense possibly damaging 0.68
IGL01020:Kif21b APN 1 136,081,832 (GRCm39) splice site probably benign
IGL01288:Kif21b APN 1 136,099,922 (GRCm39) missense probably benign 0.00
IGL02105:Kif21b APN 1 136,099,041 (GRCm39) missense probably benign
IGL02264:Kif21b APN 1 136,087,495 (GRCm39) missense probably damaging 1.00
IGL02303:Kif21b APN 1 136,087,495 (GRCm39) missense probably damaging 1.00
IGL02308:Kif21b APN 1 136,087,495 (GRCm39) missense probably damaging 1.00
IGL02310:Kif21b APN 1 136,087,495 (GRCm39) missense probably damaging 1.00
IGL02419:Kif21b APN 1 136,079,005 (GRCm39) missense probably benign 0.00
IGL02553:Kif21b APN 1 136,081,859 (GRCm39) missense probably damaging 1.00
IGL02568:Kif21b APN 1 136,100,605 (GRCm39) missense probably damaging 0.96
IGL02657:Kif21b APN 1 136,099,968 (GRCm39) missense possibly damaging 0.88
IGL03068:Kif21b APN 1 136,086,093 (GRCm39) unclassified probably benign
IGL03230:Kif21b APN 1 136,090,550 (GRCm39) missense probably benign 0.03
R0629_Kif21b_729 UTSW 1 136,099,895 (GRCm39) critical splice acceptor site probably null
Schiessen UTSW 1 136,075,607 (GRCm39) critical splice donor site probably null
wolfen UTSW 1 136,072,496 (GRCm39) nonsense probably null
R0190:Kif21b UTSW 1 136,098,957 (GRCm39) missense probably benign 0.32
R0349:Kif21b UTSW 1 136,077,049 (GRCm39) missense probably damaging 0.97
R0501:Kif21b UTSW 1 136,090,837 (GRCm39) missense probably benign 0.44
R0620:Kif21b UTSW 1 136,087,166 (GRCm39) missense possibly damaging 0.88
R0629:Kif21b UTSW 1 136,099,895 (GRCm39) critical splice acceptor site probably null
R0741:Kif21b UTSW 1 136,087,482 (GRCm39) missense probably damaging 1.00
R1087:Kif21b UTSW 1 136,090,561 (GRCm39) missense probably damaging 1.00
R1217:Kif21b UTSW 1 136,080,114 (GRCm39) missense probably damaging 1.00
R1464:Kif21b UTSW 1 136,083,891 (GRCm39) missense possibly damaging 0.50
R1464:Kif21b UTSW 1 136,083,891 (GRCm39) missense possibly damaging 0.50
R1511:Kif21b UTSW 1 136,097,062 (GRCm39) critical splice donor site probably null
R1512:Kif21b UTSW 1 136,080,543 (GRCm39) missense probably benign 0.01
R1513:Kif21b UTSW 1 136,083,849 (GRCm39) missense probably damaging 0.98
R1591:Kif21b UTSW 1 136,077,055 (GRCm39) missense probably damaging 1.00
R1616:Kif21b UTSW 1 136,099,423 (GRCm39) missense probably damaging 1.00
R1628:Kif21b UTSW 1 136,098,958 (GRCm39) missense probably benign 0.01
R1658:Kif21b UTSW 1 136,099,023 (GRCm39) missense probably damaging 1.00
R1728:Kif21b UTSW 1 136,087,859 (GRCm39) missense possibly damaging 0.85
R1741:Kif21b UTSW 1 136,083,880 (GRCm39) missense probably damaging 1.00
R1784:Kif21b UTSW 1 136,087,859 (GRCm39) missense possibly damaging 0.85
R1807:Kif21b UTSW 1 136,075,531 (GRCm39) missense possibly damaging 0.94
R1896:Kif21b UTSW 1 136,075,583 (GRCm39) missense possibly damaging 0.90
R1970:Kif21b UTSW 1 136,098,894 (GRCm39) missense probably damaging 1.00
R1984:Kif21b UTSW 1 136,075,284 (GRCm39) missense probably damaging 1.00
R1985:Kif21b UTSW 1 136,075,284 (GRCm39) missense probably damaging 1.00
R1986:Kif21b UTSW 1 136,075,284 (GRCm39) missense probably damaging 1.00
R1988:Kif21b UTSW 1 136,080,002 (GRCm39) missense probably damaging 0.98
R1990:Kif21b UTSW 1 136,089,508 (GRCm39) missense probably damaging 1.00
R2014:Kif21b UTSW 1 136,076,020 (GRCm39) missense probably damaging 1.00
R2045:Kif21b UTSW 1 136,088,051 (GRCm39) missense probably damaging 1.00
R2141:Kif21b UTSW 1 136,080,002 (GRCm39) missense probably damaging 0.98
R2248:Kif21b UTSW 1 136,100,704 (GRCm39) missense probably damaging 1.00
R2886:Kif21b UTSW 1 136,075,612 (GRCm39) splice site probably benign
R2896:Kif21b UTSW 1 136,081,955 (GRCm39) missense possibly damaging 0.82
R3706:Kif21b UTSW 1 136,087,148 (GRCm39) missense probably benign 0.06
R3780:Kif21b UTSW 1 136,083,964 (GRCm39) missense probably damaging 0.99
R3827:Kif21b UTSW 1 136,090,732 (GRCm39) critical splice donor site probably null
R4227:Kif21b UTSW 1 136,081,831 (GRCm39) splice site probably null
R4600:Kif21b UTSW 1 136,075,602 (GRCm39) missense probably benign 0.39
R4608:Kif21b UTSW 1 136,075,924 (GRCm39) intron probably benign
R4749:Kif21b UTSW 1 136,072,487 (GRCm39) nonsense probably null
R4841:Kif21b UTSW 1 136,072,958 (GRCm39) missense probably damaging 1.00
R4842:Kif21b UTSW 1 136,072,958 (GRCm39) missense probably damaging 1.00
R4933:Kif21b UTSW 1 136,079,063 (GRCm39) splice site probably null
R4959:Kif21b UTSW 1 136,076,108 (GRCm39) missense possibly damaging 0.90
R5018:Kif21b UTSW 1 136,099,972 (GRCm39) missense probably benign 0.30
R5116:Kif21b UTSW 1 136,080,521 (GRCm39) missense probably damaging 0.99
R5119:Kif21b UTSW 1 136,090,838 (GRCm39) missense probably benign
R5197:Kif21b UTSW 1 136,072,363 (GRCm39) missense probably damaging 1.00
R5230:Kif21b UTSW 1 136,099,411 (GRCm39) missense probably damaging 1.00
R5249:Kif21b UTSW 1 136,096,966 (GRCm39) missense probably damaging 1.00
R5337:Kif21b UTSW 1 136,098,881 (GRCm39) missense probably damaging 1.00
R5358:Kif21b UTSW 1 136,100,030 (GRCm39) missense possibly damaging 0.85
R5466:Kif21b UTSW 1 136,075,263 (GRCm39) missense probably damaging 1.00
R5557:Kif21b UTSW 1 136,097,797 (GRCm39) missense probably damaging 1.00
R5727:Kif21b UTSW 1 136,097,747 (GRCm39) missense probably damaging 1.00
R5865:Kif21b UTSW 1 136,078,875 (GRCm39) nonsense probably null
R5929:Kif21b UTSW 1 136,078,945 (GRCm39) missense probably damaging 1.00
R6349:Kif21b UTSW 1 136,086,064 (GRCm39) missense probably damaging 1.00
R6648:Kif21b UTSW 1 136,080,135 (GRCm39) missense probably benign 0.00
R6831:Kif21b UTSW 1 136,072,496 (GRCm39) nonsense probably null
R7156:Kif21b UTSW 1 136,075,562 (GRCm39) missense probably damaging 1.00
R7165:Kif21b UTSW 1 136,077,186 (GRCm39) missense probably damaging 0.98
R7327:Kif21b UTSW 1 136,087,387 (GRCm39) missense possibly damaging 0.60
R7680:Kif21b UTSW 1 136,075,607 (GRCm39) critical splice donor site probably null
R7975:Kif21b UTSW 1 136,098,911 (GRCm39) missense probably damaging 1.00
R8356:Kif21b UTSW 1 136,100,683 (GRCm39) missense probably damaging 1.00
R8467:Kif21b UTSW 1 136,100,021 (GRCm39) missense probably damaging 0.98
R9031:Kif21b UTSW 1 136,073,042 (GRCm39) missense probably damaging 0.99
R9101:Kif21b UTSW 1 136,078,893 (GRCm39) missense probably damaging 0.96
R9191:Kif21b UTSW 1 136,100,559 (GRCm39) nonsense probably null
R9261:Kif21b UTSW 1 136,077,162 (GRCm39) missense probably damaging 1.00
R9280:Kif21b UTSW 1 136,099,445 (GRCm39) critical splice donor site probably null
R9307:Kif21b UTSW 1 136,101,800 (GRCm39) missense probably benign
R9562:Kif21b UTSW 1 136,077,090 (GRCm39) missense probably damaging 0.99
R9563:Kif21b UTSW 1 136,077,166 (GRCm39) missense probably damaging 1.00
R9565:Kif21b UTSW 1 136,077,090 (GRCm39) missense probably damaging 0.99
R9758:Kif21b UTSW 1 136,080,961 (GRCm39) missense probably damaging 1.00
R9760:Kif21b UTSW 1 136,076,421 (GRCm39) missense probably damaging 1.00
RF024:Kif21b UTSW 1 136,086,079 (GRCm39) missense probably damaging 1.00
X0053:Kif21b UTSW 1 136,077,054 (GRCm39) missense probably damaging 1.00
X0066:Kif21b UTSW 1 136,100,683 (GRCm39) missense probably damaging 1.00
Z1176:Kif21b UTSW 1 136,081,875 (GRCm39) missense probably benign 0.00
Z1177:Kif21b UTSW 1 136,076,050 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCCACTCTTAGCCAGACC -3'
(R):5'- TCAGCCTGCACTGGTTTTGC -3'

Sequencing Primer
(F):5'- ACCATCATGATCGCCTGTGTGAG -3'
(R):5'- AGTACTGGGACCCACATCTGATG -3'
Posted On 2018-03-15