Incidental Mutation 'R6274:Sclt1'
ID507510
Institutional Source Beutler Lab
Gene Symbol Sclt1
Ensembl Gene ENSMUSG00000059834
Gene Namesodium channel and clathrin linker 1
Synonyms2610207F23Rik, 4931421F20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R6274 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location41626720-41742514 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 41629516 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026866] [ENSMUST00000146125] [ENSMUST00000148769]
Predicted Effect probably null
Transcript: ENSMUST00000026866
SMART Domains Protein: ENSMUSP00000026866
Gene: ENSMUSG00000059834

DomainStartEndE-ValueType
coiled coil region 59 105 N/A INTRINSIC
internal_repeat_1 166 179 6.29e-5 PROSPERO
coiled coil region 372 543 N/A INTRINSIC
internal_repeat_1 555 568 6.29e-5 PROSPERO
coiled coil region 571 675 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142908
Predicted Effect probably benign
Transcript: ENSMUST00000146125
Predicted Effect probably benign
Transcript: ENSMUST00000148769
SMART Domains Protein: ENSMUSP00000123392
Gene: ENSMUSG00000059834

DomainStartEndE-ValueType
coiled coil region 59 105 N/A INTRINSIC
coiled coil region 178 333 N/A INTRINSIC
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein. Studies of a related gene in rat suggest that the encoded protein functions to link clathrin to the sodium channel protein type 10 subunit alpha protein. The encoded protein has also been identified as a component of distal appendages of centrioles that is necessary for ciliogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous knockout causes polycystic kidney disease, impaired postnatal weight gain and premature death (before 1 month of age). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ano1 A T 7: 144,618,863 S528T probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Bcl2l10 T C 9: 75,351,072 I172T possibly damaging Het
Bpifb3 A T 2: 153,929,323 N385I possibly damaging Het
Bsnd A G 4: 106,486,635 V158A probably damaging Het
Cacna1s A G 1: 136,089,045 N481S probably benign Het
Cdk5rap1 A G 2: 154,368,241 V138A probably damaging Het
Cep290 A G 10: 100,530,207 E1099G probably damaging Het
Cers1 T A 8: 70,331,077 L225Q probably damaging Het
Cfb T C 17: 34,862,093 Q7R probably benign Het
Clk4 A G 11: 51,271,921 S98G possibly damaging Het
Clock A G 5: 76,237,153 S406P probably benign Het
Csmd3 T C 15: 47,621,437 I3178V probably benign Het
Dock10 A G 1: 80,538,823 S1397P probably damaging Het
Fer1l4 A G 2: 156,029,268 L1421P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Greb1 G T 12: 16,735,151 T91K probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
Gucy1b2 A T 14: 62,415,939 C336S probably damaging Het
Hdac1 A G 4: 129,519,109 C261R probably damaging Het
Hrasls5 C T 19: 7,637,466 T231I probably damaging Het
Htt T C 5: 34,852,087 S1471P possibly damaging Het
Ice1 A G 13: 70,594,839 V2134A probably damaging Het
Ikzf1 C T 11: 11,768,961 Q310* probably null Het
Il3ra G A 14: 14,350,180 V112I probably benign Het
Kif21b A G 1: 136,149,418 I393V possibly damaging Het
Krt74 T C 15: 101,763,437 noncoding transcript Het
Krtap29-1 T C 11: 99,978,983 N24S probably null Het
Mut T C 17: 40,956,245 V570A probably benign Het
Myh7 T C 14: 54,979,486 D1138G probably damaging Het
Nktr T C 9: 121,731,565 I125T probably damaging Het
Nlrp2 A T 7: 5,317,555 L861Q probably damaging Het
Notch3 C A 17: 32,147,290 R990L probably benign Het
Nrap T C 19: 56,361,721 D655G probably benign Het
Olfr1329 A T 4: 118,917,230 V79E probably benign Het
Olfr1451 G A 19: 12,999,870 V295I probably damaging Het
Osbpl11 T A 16: 33,227,056 I463N probably damaging Het
Pcsk6 A T 7: 66,033,844 R749W probably damaging Het
Plxnb1 T C 9: 109,112,141 probably null Het
Polr1a T A 6: 71,954,890 probably null Het
Ppm1g T C 5: 31,206,406 I153V probably damaging Het
Ppp1r12a T C 10: 108,260,890 S191P probably benign Het
Prodh T C 16: 18,081,058 K178E possibly damaging Het
Rilpl2 A G 5: 124,469,848 V103A possibly damaging Het
Sap18b C T 8: 95,825,541 H60Y probably benign Het
Serpinb1a G T 13: 32,842,866 H364Q probably damaging Het
Sez6l G A 5: 112,475,365 Q107* probably null Het
Sipa1l2 C T 8: 125,469,872 V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Uaca T A 9: 60,850,291 probably null Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Usp9y C T Y: 1,316,735 R1938H probably damaging Homo
Wnk4 C T 11: 101,265,431 R42W probably damaging Het
Zfp326 T A 5: 105,905,980 L242Q probably damaging Het
Other mutations in Sclt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Sclt1 APN 3 41741991 unclassified probably benign
IGL01106:Sclt1 APN 3 41675319 splice site probably benign
IGL01368:Sclt1 APN 3 41711175 missense probably damaging 0.96
IGL02001:Sclt1 APN 3 41681721 missense possibly damaging 0.63
IGL02897:Sclt1 APN 3 41675387 missense probably benign 0.01
IGL03066:Sclt1 APN 3 41717843 missense probably benign 0.00
R0038:Sclt1 UTSW 3 41629508 splice site probably benign
R0038:Sclt1 UTSW 3 41629508 splice site probably benign
R0172:Sclt1 UTSW 3 41717787 missense possibly damaging 0.84
R0359:Sclt1 UTSW 3 41661570 critical splice donor site probably null
R1281:Sclt1 UTSW 3 41647620 missense probably benign 0.01
R1831:Sclt1 UTSW 3 41727111 missense probably damaging 0.99
R1832:Sclt1 UTSW 3 41727111 missense probably damaging 0.99
R1833:Sclt1 UTSW 3 41727111 missense probably damaging 0.99
R2027:Sclt1 UTSW 3 41730888 missense probably benign 0.00
R4578:Sclt1 UTSW 3 41671465 nonsense probably null
R5502:Sclt1 UTSW 3 41657275 missense probably benign 0.28
R5558:Sclt1 UTSW 3 41661590 missense probably benign 0.14
R5601:Sclt1 UTSW 3 41730919 missense probably benign
R5710:Sclt1 UTSW 3 41663963 nonsense probably null
R6041:Sclt1 UTSW 3 41627177 missense probably damaging 0.99
R6765:Sclt1 UTSW 3 41730902 missense unknown
R7171:Sclt1 UTSW 3 41717760 missense probably benign 0.00
R7489:Sclt1 UTSW 3 41629597 missense probably damaging 0.99
R8040:Sclt1 UTSW 3 41657376 missense probably damaging 1.00
R8158:Sclt1 UTSW 3 41671482 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TGGCTACCAGAGATACATGGTAG -3'
(R):5'- TTTGCAAGTAGGAAATAAGGTCCAG -3'

Sequencing Primer
(F):5'- CCAGAGATACATGGTAGTTTTAGATG -3'
(R):5'- AATAAGGTCCAGGTTTTTCATTGGC -3'
Posted On2018-03-15