Mutagenetix > Incidental Mutation

Incidental Mutation 'R6274:Sclt1'

507510

Institutional Source

Beutler Lab

Gene Symbol

Sclt1

Ensembl Gene

ENSMUSG00000059834

Gene Name

sodium channel and clathrin linker 1

Synonyms

2610207F23Rik, 4931421F20Rik

MMRRC Submission

044444-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.248) question?

Stock #

R6274 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

41626720-41742514 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 41629516 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000026866 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026866] [ENSMUST00000146125] [ENSMUST00000148769]

AlphaFold

G5E861

Predicted Effect

probably null
Transcript: ENSMUST00000026866

SMART Domains

Protein: ENSMUSP00000026866
Gene: ENSMUSG00000059834

Domain	Start	End	E-Value	Type
coiled coil region	59	105	N/A	INTRINSIC
internal_repeat_1	166	179	6.29e-5	PROSPERO
coiled coil region	372	543	N/A	INTRINSIC
internal_repeat_1	555	568	6.29e-5	PROSPERO
coiled coil region	571	675	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140373

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142908

Predicted Effect

probably benign
Transcript: ENSMUST00000146125

Predicted Effect

probably benign
Transcript: ENSMUST00000148769

SMART Domains

Protein: ENSMUSP00000123392
Gene: ENSMUSG00000059834

Domain	Start	End	E-Value	Type
coiled coil region	59	105	N/A	INTRINSIC
coiled coil region	178	333	N/A	INTRINSIC

Meta Mutation Damage Score

0.9491

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.1%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein. Studies of a related gene in rat suggest that the encoded protein functions to link clathrin to the sodium channel protein type 10 subunit alpha protein. The encoded protein has also been identified as a component of distal appendages of centrioles that is necessary for ciliogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous knockout causes polycystic kidney disease, impaired postnatal weight gain and premature death (before 1 month of age). [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ano1	A	T	7: 144,618,863	S528T	probably benign	Het
Araf	G	T	X: 20,860,100	R601L	probably damaging	Homo
Bcl2l10	T	C	9: 75,351,072	I172T	possibly damaging	Het
Bpifb3	A	T	2: 153,929,323	N385I	possibly damaging	Het
Bsnd	A	G	4: 106,486,635	V158A	probably damaging	Het
Cacna1s	A	G	1: 136,089,045	N481S	probably benign	Het
Cdk5rap1	A	G	2: 154,368,241	V138A	probably damaging	Het
Cep290	A	G	10: 100,530,207	E1099G	probably damaging	Het
Cers1	T	A	8: 70,331,077	L225Q	probably damaging	Het
Cfb	T	C	17: 34,862,093	Q7R	probably benign	Het
Clk4	A	G	11: 51,271,921	S98G	possibly damaging	Het
Clock	A	G	5: 76,237,153	S406P	probably benign	Het
Csmd3	T	C	15: 47,621,437	I3178V	probably benign	Het
Dock10	A	G	1: 80,538,823	S1397P	probably damaging	Het
Fer1l4	A	G	2: 156,029,268	L1421P	probably damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Greb1	G	T	12: 16,735,151	T91K	probably damaging	Het
Grid2ip	G	A	5: 143,380,429	S379N	probably damaging	Het
Gucy1b2	A	T	14: 62,415,939	C336S	probably damaging	Het
Hdac1	A	G	4: 129,519,109	C261R	probably damaging	Het
Hrasls5	C	T	19: 7,637,466	T231I	probably damaging	Het
Htt	T	C	5: 34,852,087	S1471P	possibly damaging	Het
Ice1	A	G	13: 70,594,839	V2134A	probably damaging	Het
Ikzf1	C	T	11: 11,768,961	Q310*	probably null	Het
Il3ra	G	A	14: 14,350,180	V112I	probably benign	Het
Kif21b	A	G	1: 136,149,418	I393V	possibly damaging	Het
Krt74	T	C	15: 101,763,437		noncoding transcript	Het
Krtap29-1	T	C	11: 99,978,983	N24S	probably null	Het
Mut	T	C	17: 40,956,245	V570A	probably benign	Het
Myh7	T	C	14: 54,979,486	D1138G	probably damaging	Het
Nktr	T	C	9: 121,731,565	I125T	probably damaging	Het
Nlrp2	A	T	7: 5,317,555	L861Q	probably damaging	Het
Notch3	C	A	17: 32,147,290	R990L	probably benign	Het
Nrap	T	C	19: 56,361,721	D655G	probably benign	Het
Olfr1329	A	T	4: 118,917,230	V79E	probably benign	Het
Olfr1451	G	A	19: 12,999,870	V295I	probably damaging	Het
Osbpl11	T	A	16: 33,227,056	I463N	probably damaging	Het
Pcsk6	A	T	7: 66,033,844	R749W	probably damaging	Het
Plxnb1	T	C	9: 109,112,141		probably null	Het
Polr1a	T	A	6: 71,954,890		probably null	Het
Ppm1g	T	C	5: 31,206,406	I153V	probably damaging	Het
Ppp1r12a	T	C	10: 108,260,890	S191P	probably benign	Het
Prodh	T	C	16: 18,081,058	K178E	possibly damaging	Het
Rilpl2	A	G	5: 124,469,848	V103A	possibly damaging	Het
Sap18b	C	T	8: 95,825,541	H60Y	probably benign	Het
Serpinb1a	G	T	13: 32,842,866	H364Q	probably damaging	Het
Sez6l	G	A	5: 112,475,365	Q107*	probably null	Het
Sipa1l2	C	T	8: 125,469,872	V708I	probably damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Uaca	T	A	9: 60,850,291		probably null	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Usp9y	C	T	Y: 1,316,735	R1938H	probably damaging	Homo
Wnk4	C	T	11: 101,265,431	R42W	probably damaging	Het
Zfp326	T	A	5: 105,905,980	L242Q	probably damaging	Het

Other mutations in Sclt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01069:Sclt1	APN	3	41741991	unclassified	probably benign
IGL01106:Sclt1	APN	3	41675319	splice site	probably benign
IGL01368:Sclt1	APN	3	41711175	missense	probably damaging	0.96
IGL02001:Sclt1	APN	3	41681721	missense	possibly damaging	0.63
IGL02897:Sclt1	APN	3	41675387	missense	probably benign	0.01
IGL03066:Sclt1	APN	3	41717843	missense	probably benign	0.00
R0038:Sclt1	UTSW	3	41629508	splice site	probably benign
R0038:Sclt1	UTSW	3	41629508	splice site	probably benign
R0172:Sclt1	UTSW	3	41717787	missense	possibly damaging	0.84
R0359:Sclt1	UTSW	3	41661570	critical splice donor site	probably null
R1281:Sclt1	UTSW	3	41647620	missense	probably benign	0.01
R1831:Sclt1	UTSW	3	41727111	missense	probably damaging	0.99
R1832:Sclt1	UTSW	3	41727111	missense	probably damaging	0.99
R1833:Sclt1	UTSW	3	41727111	missense	probably damaging	0.99
R2027:Sclt1	UTSW	3	41730888	missense	probably benign	0.00
R4578:Sclt1	UTSW	3	41671465	nonsense	probably null
R5502:Sclt1	UTSW	3	41657275	missense	probably benign	0.28
R5558:Sclt1	UTSW	3	41661590	missense	probably benign	0.14
R5601:Sclt1	UTSW	3	41730919	missense	probably benign
R5710:Sclt1	UTSW	3	41663963	nonsense	probably null
R6041:Sclt1	UTSW	3	41627177	missense	probably damaging	0.99
R6765:Sclt1	UTSW	3	41730902	missense	unknown
R7171:Sclt1	UTSW	3	41717760	missense	probably benign	0.00
R7489:Sclt1	UTSW	3	41629597	missense	probably damaging	0.99
R7988:Sclt1	UTSW	3	41663454	makesense	probably null
R8040:Sclt1	UTSW	3	41657376	missense	probably damaging	1.00
R8158:Sclt1	UTSW	3	41671482	missense	probably benign	0.36
R8383:Sclt1	UTSW	3	41742015	missense	probably benign	0.13
R8956:Sclt1	UTSW	3	41681774	missense	probably benign	0.01
R8971:Sclt1	UTSW	3	41727106	missense	probably benign	0.01
R9227:Sclt1	UTSW	3	41711196	missense	probably benign	0.01
R9230:Sclt1	UTSW	3	41711196	missense	probably benign	0.01
R9463:Sclt1	UTSW	3	41647496	missense	probably damaging	1.00
R9729:Sclt1	UTSW	3	41675402	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGCTACCAGAGATACATGGTAG -3'
(R):5'- TTTGCAAGTAGGAAATAAGGTCCAG -3'

Sequencing Primer
(F):5'- CCAGAGATACATGGTAGTTTTAGATG -3'
(R):5'- AATAAGGTCCAGGTTTTTCATTGGC -3'

Posted On

2018-03-15