Incidental Mutation 'R6274:Tbc1d2'
ID 507511
Institutional Source Beutler Lab
Gene Symbol Tbc1d2
Ensembl Gene ENSMUSG00000039813
Gene Name TBC1 domain family, member 2
Synonyms PARIS-1, LOC381605, PARIS1, A630005A06Rik
MMRRC Submission 044444-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.167) question?
Stock # R6274 (G1)
Quality Score 200.009
Status Validated
Chromosome 4
Chromosomal Location 46604390-46650209 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 46629912 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 252 (G252R)
Ref Sequence ENSEMBL: ENSMUSP00000081670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084621] [ENSMUST00000107750]
AlphaFold B1AVH7
Predicted Effect probably benign
Transcript: ENSMUST00000084621
AA Change: G252R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000081670
Gene: ENSMUSG00000039813
AA Change: G252R

DomainStartEndE-ValueType
PH 44 143 1.94e-11 SMART
low complexity region 147 159 N/A INTRINSIC
low complexity region 165 180 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
coiled coil region 302 333 N/A INTRINSIC
coiled coil region 362 394 N/A INTRINSIC
low complexity region 398 410 N/A INTRINSIC
Blast:TBC 454 491 3e-14 BLAST
low complexity region 526 539 N/A INTRINSIC
Blast:TBC 557 591 3e-10 BLAST
TBC 616 834 1.63e-60 SMART
coiled coil region 869 906 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107750
SMART Domains Protein: ENSMUSP00000103379
Gene: ENSMUSG00000039813

DomainStartEndE-ValueType
PH 44 143 1.94e-11 SMART
low complexity region 147 159 N/A INTRINSIC
low complexity region 165 180 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Ano1 A T 7: 144,172,600 (GRCm39) S528T probably benign Het
Araf G T X: 20,726,339 (GRCm39) R601L probably damaging Homo
Bcl2l10 T C 9: 75,258,354 (GRCm39) I172T possibly damaging Het
Bpifb3 A T 2: 153,771,243 (GRCm39) N385I possibly damaging Het
Bsnd A G 4: 106,343,832 (GRCm39) V158A probably damaging Het
Cacna1s A G 1: 136,016,783 (GRCm39) N481S probably benign Het
Cdk5rap1 A G 2: 154,210,161 (GRCm39) V138A probably damaging Het
Cep290 A G 10: 100,366,069 (GRCm39) E1099G probably damaging Het
Cers1 T A 8: 70,783,727 (GRCm39) L225Q probably damaging Het
Cfb T C 17: 35,081,069 (GRCm39) Q7R probably benign Het
Clk4 A G 11: 51,162,748 (GRCm39) S98G possibly damaging Het
Clock A G 5: 76,385,000 (GRCm39) S406P probably benign Het
Csmd3 T C 15: 47,484,833 (GRCm39) I3178V probably benign Het
Dock10 A G 1: 80,516,540 (GRCm39) S1397P probably damaging Het
Fer1l4 A G 2: 155,871,188 (GRCm39) L1421P probably damaging Het
Fetub C T 16: 22,751,081 (GRCm39) R143C probably damaging Het
Greb1 G T 12: 16,785,152 (GRCm39) T91K probably damaging Het
Grid2ip G A 5: 143,366,184 (GRCm39) S379N probably damaging Het
Gucy1b2 A T 14: 62,653,388 (GRCm39) C336S probably damaging Het
Hdac1 A G 4: 129,412,902 (GRCm39) C261R probably damaging Het
Htt T C 5: 35,009,431 (GRCm39) S1471P possibly damaging Het
Ice1 A G 13: 70,742,958 (GRCm39) V2134A probably damaging Het
Ikzf1 C T 11: 11,718,961 (GRCm39) Q310* probably null Het
Il3ra G A 14: 14,350,180 (GRCm38) V112I probably benign Het
Kif21b A G 1: 136,077,156 (GRCm39) I393V possibly damaging Het
Krt74 T C 15: 101,671,872 (GRCm39) noncoding transcript Het
Krtap29-1 T C 11: 99,869,809 (GRCm39) N24S probably null Het
Mmut T C 17: 41,267,136 (GRCm39) V570A probably benign Het
Myh7 T C 14: 55,216,943 (GRCm39) D1138G probably damaging Het
Nktr T C 9: 121,560,631 (GRCm39) I125T probably damaging Het
Nlrp2 A T 7: 5,320,554 (GRCm39) L861Q probably damaging Het
Notch3 C A 17: 32,366,264 (GRCm39) R990L probably benign Het
Nrap T C 19: 56,350,153 (GRCm39) D655G probably benign Het
Or10ak8 A T 4: 118,774,427 (GRCm39) V79E probably benign Het
Or5b99 G A 19: 12,977,234 (GRCm39) V295I probably damaging Het
Osbpl11 T A 16: 33,047,426 (GRCm39) I463N probably damaging Het
Pcsk6 A T 7: 65,683,592 (GRCm39) R749W probably damaging Het
Plaat5 C T 19: 7,614,831 (GRCm39) T231I probably damaging Het
Plxnb1 T C 9: 108,941,209 (GRCm39) probably null Het
Polr1a T A 6: 71,931,874 (GRCm39) probably null Het
Ppm1g T C 5: 31,363,750 (GRCm39) I153V probably damaging Het
Ppp1r12a T C 10: 108,096,751 (GRCm39) S191P probably benign Het
Prodh T C 16: 17,898,922 (GRCm39) K178E possibly damaging Het
Rilpl2 A G 5: 124,607,911 (GRCm39) V103A possibly damaging Het
Sap18b C T 8: 96,552,169 (GRCm39) H60Y probably benign Het
Sclt1 A G 3: 41,583,951 (GRCm39) probably null Het
Serpinb1a G T 13: 33,026,849 (GRCm39) H364Q probably damaging Het
Sez6l G A 5: 112,623,231 (GRCm39) Q107* probably null Het
Sipa1l2 C T 8: 126,196,611 (GRCm39) V708I probably damaging Het
Uaca T A 9: 60,757,573 (GRCm39) probably null Het
Uqcrc1 C A 9: 108,771,224 (GRCm39) H95N probably damaging Het
Usp9y C T Y: 1,316,735 (GRCm39) R1938H probably damaging Homo
Wnk4 C T 11: 101,156,257 (GRCm39) R42W probably damaging Het
Zfp326 T A 5: 106,053,846 (GRCm39) L242Q probably damaging Het
Other mutations in Tbc1d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Tbc1d2 APN 4 46,649,745 (GRCm39) missense probably benign 0.04
IGL01748:Tbc1d2 APN 4 46,616,306 (GRCm39) missense probably damaging 0.99
IGL01863:Tbc1d2 APN 4 46,607,064 (GRCm39) missense possibly damaging 0.66
IGL02014:Tbc1d2 APN 4 46,649,778 (GRCm39) missense possibly damaging 0.83
IGL02025:Tbc1d2 APN 4 46,620,713 (GRCm39) missense probably damaging 1.00
IGL02551:Tbc1d2 APN 4 46,649,916 (GRCm39) missense probably benign
IGL02571:Tbc1d2 APN 4 46,628,370 (GRCm39) missense probably benign 0.00
IGL03149:Tbc1d2 APN 4 46,637,619 (GRCm39) missense probably benign 0.31
R0347:Tbc1d2 UTSW 4 46,620,574 (GRCm39) missense possibly damaging 0.82
R0374:Tbc1d2 UTSW 4 46,649,913 (GRCm39) missense possibly damaging 0.95
R0522:Tbc1d2 UTSW 4 46,649,806 (GRCm39) missense probably damaging 1.00
R0883:Tbc1d2 UTSW 4 46,609,003 (GRCm39) nonsense probably null
R1227:Tbc1d2 UTSW 4 46,620,629 (GRCm39) missense probably benign 0.00
R1464:Tbc1d2 UTSW 4 46,606,491 (GRCm39) missense possibly damaging 0.51
R1464:Tbc1d2 UTSW 4 46,606,491 (GRCm39) missense possibly damaging 0.51
R1658:Tbc1d2 UTSW 4 46,614,207 (GRCm39) missense probably damaging 1.00
R1959:Tbc1d2 UTSW 4 46,606,419 (GRCm39) missense probably benign 0.44
R2108:Tbc1d2 UTSW 4 46,637,652 (GRCm39) missense possibly damaging 0.62
R3864:Tbc1d2 UTSW 4 46,620,484 (GRCm39) missense probably benign 0.01
R4475:Tbc1d2 UTSW 4 46,609,080 (GRCm39) missense possibly damaging 0.92
R5112:Tbc1d2 UTSW 4 46,606,503 (GRCm39) missense probably damaging 1.00
R5127:Tbc1d2 UTSW 4 46,633,639 (GRCm39) intron probably benign
R5215:Tbc1d2 UTSW 4 46,614,006 (GRCm39) missense probably benign 0.42
R5475:Tbc1d2 UTSW 4 46,629,912 (GRCm39) missense probably benign 0.01
R5550:Tbc1d2 UTSW 4 46,646,138 (GRCm39) missense probably benign 0.00
R5558:Tbc1d2 UTSW 4 46,629,912 (GRCm39) missense probably benign 0.01
R5564:Tbc1d2 UTSW 4 46,629,912 (GRCm39) missense probably benign 0.01
R5599:Tbc1d2 UTSW 4 46,629,912 (GRCm39) missense probably benign 0.01
R5600:Tbc1d2 UTSW 4 46,629,912 (GRCm39) missense probably benign 0.01
R5699:Tbc1d2 UTSW 4 46,616,298 (GRCm39) missense probably benign 0.31
R5866:Tbc1d2 UTSW 4 46,637,715 (GRCm39) missense possibly damaging 0.80
R5909:Tbc1d2 UTSW 4 46,629,912 (GRCm39) missense probably benign 0.01
R5911:Tbc1d2 UTSW 4 46,629,912 (GRCm39) missense probably benign 0.01
R5980:Tbc1d2 UTSW 4 46,629,912 (GRCm39) missense probably benign 0.01
R6194:Tbc1d2 UTSW 4 46,629,912 (GRCm39) missense probably benign 0.01
R6195:Tbc1d2 UTSW 4 46,629,912 (GRCm39) missense probably benign 0.01
R6209:Tbc1d2 UTSW 4 46,614,068 (GRCm39) missense probably damaging 1.00
R6211:Tbc1d2 UTSW 4 46,629,912 (GRCm39) missense probably benign 0.01
R6232:Tbc1d2 UTSW 4 46,629,912 (GRCm39) missense probably benign 0.01
R6242:Tbc1d2 UTSW 4 46,629,912 (GRCm39) missense probably benign 0.01
R6261:Tbc1d2 UTSW 4 46,637,692 (GRCm39) missense possibly damaging 0.47
R6273:Tbc1d2 UTSW 4 46,629,912 (GRCm39) missense probably benign 0.01
R6285:Tbc1d2 UTSW 4 46,615,045 (GRCm39) missense possibly damaging 0.49
R6333:Tbc1d2 UTSW 4 46,620,736 (GRCm39) missense possibly damaging 0.64
R6369:Tbc1d2 UTSW 4 46,614,420 (GRCm39) missense probably benign 0.41
R6912:Tbc1d2 UTSW 4 46,649,712 (GRCm39) missense probably damaging 1.00
R7428:Tbc1d2 UTSW 4 46,649,965 (GRCm39) missense probably benign 0.02
R7775:Tbc1d2 UTSW 4 46,637,746 (GRCm39) splice site probably null
R7824:Tbc1d2 UTSW 4 46,637,746 (GRCm39) splice site probably null
R8069:Tbc1d2 UTSW 4 46,649,737 (GRCm39) missense possibly damaging 0.81
R8135:Tbc1d2 UTSW 4 46,609,071 (GRCm39) missense probably benign 0.31
R8203:Tbc1d2 UTSW 4 46,606,476 (GRCm39) missense probably damaging 1.00
R8271:Tbc1d2 UTSW 4 46,649,791 (GRCm39) missense possibly damaging 0.88
R8690:Tbc1d2 UTSW 4 46,615,106 (GRCm39) missense possibly damaging 0.95
R9025:Tbc1d2 UTSW 4 46,607,062 (GRCm39) missense probably damaging 1.00
R9236:Tbc1d2 UTSW 4 46,609,029 (GRCm39) missense probably benign 0.08
R9622:Tbc1d2 UTSW 4 46,609,065 (GRCm39) missense probably damaging 1.00
R9776:Tbc1d2 UTSW 4 46,650,007 (GRCm39) missense probably benign 0.00
X0023:Tbc1d2 UTSW 4 46,615,037 (GRCm39) missense probably benign 0.00
X0063:Tbc1d2 UTSW 4 46,606,492 (GRCm39) missense probably damaging 1.00
Z1177:Tbc1d2 UTSW 4 46,650,016 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGAGTCAGCCTGGGTGG -3'
(R):5'- GAGGCCAGAGCTCTGCAG -3'

Sequencing Primer
(F):5'- CAGCCCCATGATAGGATTAGTGTC -3'
(R):5'- AGAGCTCTGCAGGCAGC -3'
Posted On 2018-03-15