Incidental Mutation 'R6274:Tbc1d2'
ID507511
Institutional Source Beutler Lab
Gene Symbol Tbc1d2
Ensembl Gene ENSMUSG00000039813
Gene NameTBC1 domain family, member 2
SynonymsPARIS-1, A630005A06Rik, LOC381605, PARIS1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6274 (G1)
Quality Score200.009
Status Validated
Chromosome4
Chromosomal Location46604390-46650209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46629912 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 252 (G252R)
Ref Sequence ENSEMBL: ENSMUSP00000081670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084621] [ENSMUST00000107750]
Predicted Effect probably benign
Transcript: ENSMUST00000084621
AA Change: G252R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000081670
Gene: ENSMUSG00000039813
AA Change: G252R

DomainStartEndE-ValueType
PH 44 143 1.94e-11 SMART
low complexity region 147 159 N/A INTRINSIC
low complexity region 165 180 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
coiled coil region 302 333 N/A INTRINSIC
coiled coil region 362 394 N/A INTRINSIC
low complexity region 398 410 N/A INTRINSIC
Blast:TBC 454 491 3e-14 BLAST
low complexity region 526 539 N/A INTRINSIC
Blast:TBC 557 591 3e-10 BLAST
TBC 616 834 1.63e-60 SMART
coiled coil region 869 906 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107750
SMART Domains Protein: ENSMUSP00000103379
Gene: ENSMUSG00000039813

DomainStartEndE-ValueType
PH 44 143 1.94e-11 SMART
low complexity region 147 159 N/A INTRINSIC
low complexity region 165 180 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ano1 A T 7: 144,618,863 S528T probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Bcl2l10 T C 9: 75,351,072 I172T possibly damaging Het
Bpifb3 A T 2: 153,929,323 N385I possibly damaging Het
Bsnd A G 4: 106,486,635 V158A probably damaging Het
Cacna1s A G 1: 136,089,045 N481S probably benign Het
Cdk5rap1 A G 2: 154,368,241 V138A probably damaging Het
Cep290 A G 10: 100,530,207 E1099G probably damaging Het
Cers1 T A 8: 70,331,077 L225Q probably damaging Het
Cfb T C 17: 34,862,093 Q7R probably benign Het
Clk4 A G 11: 51,271,921 S98G possibly damaging Het
Clock A G 5: 76,237,153 S406P probably benign Het
Csmd3 T C 15: 47,621,437 I3178V probably benign Het
Dock10 A G 1: 80,538,823 S1397P probably damaging Het
Fer1l4 A G 2: 156,029,268 L1421P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Greb1 G T 12: 16,735,151 T91K probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
Gucy1b2 A T 14: 62,415,939 C336S probably damaging Het
Hdac1 A G 4: 129,519,109 C261R probably damaging Het
Hrasls5 C T 19: 7,637,466 T231I probably damaging Het
Htt T C 5: 34,852,087 S1471P possibly damaging Het
Ice1 A G 13: 70,594,839 V2134A probably damaging Het
Ikzf1 C T 11: 11,768,961 Q310* probably null Het
Il3ra G A 14: 14,350,180 V112I probably benign Het
Kif21b A G 1: 136,149,418 I393V possibly damaging Het
Krt74 T C 15: 101,763,437 noncoding transcript Het
Krtap29-1 T C 11: 99,978,983 N24S probably null Het
Mut T C 17: 40,956,245 V570A probably benign Het
Myh7 T C 14: 54,979,486 D1138G probably damaging Het
Nktr T C 9: 121,731,565 I125T probably damaging Het
Nlrp2 A T 7: 5,317,555 L861Q probably damaging Het
Notch3 C A 17: 32,147,290 R990L probably benign Het
Nrap T C 19: 56,361,721 D655G probably benign Het
Olfr1329 A T 4: 118,917,230 V79E probably benign Het
Olfr1451 G A 19: 12,999,870 V295I probably damaging Het
Osbpl11 T A 16: 33,227,056 I463N probably damaging Het
Pcsk6 A T 7: 66,033,844 R749W probably damaging Het
Plxnb1 T C 9: 109,112,141 probably null Het
Polr1a T A 6: 71,954,890 probably null Het
Ppm1g T C 5: 31,206,406 I153V probably damaging Het
Ppp1r12a T C 10: 108,260,890 S191P probably benign Het
Prodh T C 16: 18,081,058 K178E possibly damaging Het
Rilpl2 A G 5: 124,469,848 V103A possibly damaging Het
Sap18b C T 8: 95,825,541 H60Y probably benign Het
Sclt1 A G 3: 41,629,516 probably null Het
Serpinb1a G T 13: 32,842,866 H364Q probably damaging Het
Sez6l G A 5: 112,475,365 Q107* probably null Het
Sipa1l2 C T 8: 125,469,872 V708I probably damaging Het
Uaca T A 9: 60,850,291 probably null Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Usp9y C T Y: 1,316,735 R1938H probably damaging Homo
Wnk4 C T 11: 101,265,431 R42W probably damaging Het
Zfp326 T A 5: 105,905,980 L242Q probably damaging Het
Other mutations in Tbc1d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Tbc1d2 APN 4 46649745 missense probably benign 0.04
IGL01748:Tbc1d2 APN 4 46616306 missense probably damaging 0.99
IGL01863:Tbc1d2 APN 4 46607064 missense possibly damaging 0.66
IGL02014:Tbc1d2 APN 4 46649778 missense possibly damaging 0.83
IGL02025:Tbc1d2 APN 4 46620713 missense probably damaging 1.00
IGL02551:Tbc1d2 APN 4 46649916 missense probably benign
IGL02571:Tbc1d2 APN 4 46628370 missense probably benign 0.00
IGL03149:Tbc1d2 APN 4 46637619 missense probably benign 0.31
R0347:Tbc1d2 UTSW 4 46620574 missense possibly damaging 0.82
R0374:Tbc1d2 UTSW 4 46649913 missense possibly damaging 0.95
R0522:Tbc1d2 UTSW 4 46649806 missense probably damaging 1.00
R0883:Tbc1d2 UTSW 4 46609003 nonsense probably null
R1227:Tbc1d2 UTSW 4 46620629 missense probably benign 0.00
R1464:Tbc1d2 UTSW 4 46606491 missense possibly damaging 0.51
R1464:Tbc1d2 UTSW 4 46606491 missense possibly damaging 0.51
R1658:Tbc1d2 UTSW 4 46614207 missense probably damaging 1.00
R1959:Tbc1d2 UTSW 4 46606419 missense probably benign 0.44
R2108:Tbc1d2 UTSW 4 46637652 missense possibly damaging 0.62
R3864:Tbc1d2 UTSW 4 46620484 missense probably benign 0.01
R4475:Tbc1d2 UTSW 4 46609080 missense possibly damaging 0.92
R5112:Tbc1d2 UTSW 4 46606503 missense probably damaging 1.00
R5127:Tbc1d2 UTSW 4 46633639 intron probably benign
R5215:Tbc1d2 UTSW 4 46614006 missense probably benign 0.42
R5475:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5550:Tbc1d2 UTSW 4 46646138 missense probably benign 0.00
R5558:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5564:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5599:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5600:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5699:Tbc1d2 UTSW 4 46616298 missense probably benign 0.31
R5866:Tbc1d2 UTSW 4 46637715 missense possibly damaging 0.80
R5909:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5911:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5980:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6194:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6195:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6209:Tbc1d2 UTSW 4 46614068 missense probably damaging 1.00
R6211:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6232:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6242:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6261:Tbc1d2 UTSW 4 46637692 missense possibly damaging 0.47
R6273:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6285:Tbc1d2 UTSW 4 46615045 missense possibly damaging 0.49
R6333:Tbc1d2 UTSW 4 46620736 missense possibly damaging 0.64
R6369:Tbc1d2 UTSW 4 46614420 missense probably benign 0.41
R6912:Tbc1d2 UTSW 4 46649712 missense probably damaging 1.00
R7428:Tbc1d2 UTSW 4 46649965 missense probably benign 0.02
R7775:Tbc1d2 UTSW 4 46637746 splice site probably null
R7824:Tbc1d2 UTSW 4 46637746 splice site probably null
R8069:Tbc1d2 UTSW 4 46649737 missense possibly damaging 0.81
R8135:Tbc1d2 UTSW 4 46609071 missense probably benign 0.31
R8203:Tbc1d2 UTSW 4 46606476 missense probably damaging 1.00
R8271:Tbc1d2 UTSW 4 46649791 missense possibly damaging 0.88
X0023:Tbc1d2 UTSW 4 46615037 missense probably benign 0.00
X0063:Tbc1d2 UTSW 4 46606492 missense probably damaging 1.00
Z1177:Tbc1d2 UTSW 4 46650016 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGAGTCAGCCTGGGTGG -3'
(R):5'- GAGGCCAGAGCTCTGCAG -3'

Sequencing Primer
(F):5'- CAGCCCCATGATAGGATTAGTGTC -3'
(R):5'- AGAGCTCTGCAGGCAGC -3'
Posted On2018-03-15