Incidental Mutation 'R6274:Olfr1329'
ID507513
Institutional Source Beutler Lab
Gene Symbol Olfr1329
Ensembl Gene ENSMUSG00000096705
Gene Nameolfactory receptor 1329
SynonymsMOR259-2, GA_x6K02T2QD9B-18619941-18620882
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R6274 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location118916524-118917465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118917230 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 79 (V79E)
Ref Sequence ENSEMBL: ENSMUSP00000071870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071979]
Predicted Effect probably benign
Transcript: ENSMUST00000071979
AA Change: V79E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000071870
Gene: ENSMUSG00000096705
AA Change: V79E

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 4.3e-55 PFAM
Pfam:7TM_GPCR_Srsx 36 306 1.5e-6 PFAM
Pfam:7tm_1 42 291 5.7e-25 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ano1 A T 7: 144,618,863 S528T probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Bcl2l10 T C 9: 75,351,072 I172T possibly damaging Het
Bpifb3 A T 2: 153,929,323 N385I possibly damaging Het
Bsnd A G 4: 106,486,635 V158A probably damaging Het
Cacna1s A G 1: 136,089,045 N481S probably benign Het
Cdk5rap1 A G 2: 154,368,241 V138A probably damaging Het
Cep290 A G 10: 100,530,207 E1099G probably damaging Het
Cers1 T A 8: 70,331,077 L225Q probably damaging Het
Cfb T C 17: 34,862,093 Q7R probably benign Het
Clk4 A G 11: 51,271,921 S98G possibly damaging Het
Clock A G 5: 76,237,153 S406P probably benign Het
Csmd3 T C 15: 47,621,437 I3178V probably benign Het
Dock10 A G 1: 80,538,823 S1397P probably damaging Het
Fer1l4 A G 2: 156,029,268 L1421P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Greb1 G T 12: 16,735,151 T91K probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
Gucy1b2 A T 14: 62,415,939 C336S probably damaging Het
Hdac1 A G 4: 129,519,109 C261R probably damaging Het
Hrasls5 C T 19: 7,637,466 T231I probably damaging Het
Htt T C 5: 34,852,087 S1471P possibly damaging Het
Ice1 A G 13: 70,594,839 V2134A probably damaging Het
Ikzf1 C T 11: 11,768,961 Q310* probably null Het
Il3ra G A 14: 14,350,180 V112I probably benign Het
Kif21b A G 1: 136,149,418 I393V possibly damaging Het
Krt74 T C 15: 101,763,437 noncoding transcript Het
Krtap29-1 T C 11: 99,978,983 N24S probably null Het
Mut T C 17: 40,956,245 V570A probably benign Het
Myh7 T C 14: 54,979,486 D1138G probably damaging Het
Nktr T C 9: 121,731,565 I125T probably damaging Het
Nlrp2 A T 7: 5,317,555 L861Q probably damaging Het
Notch3 C A 17: 32,147,290 R990L probably benign Het
Nrap T C 19: 56,361,721 D655G probably benign Het
Olfr1451 G A 19: 12,999,870 V295I probably damaging Het
Osbpl11 T A 16: 33,227,056 I463N probably damaging Het
Pcsk6 A T 7: 66,033,844 R749W probably damaging Het
Plxnb1 T C 9: 109,112,141 probably null Het
Polr1a T A 6: 71,954,890 probably null Het
Ppm1g T C 5: 31,206,406 I153V probably damaging Het
Ppp1r12a T C 10: 108,260,890 S191P probably benign Het
Prodh T C 16: 18,081,058 K178E possibly damaging Het
Rilpl2 A G 5: 124,469,848 V103A possibly damaging Het
Sap18b C T 8: 95,825,541 H60Y probably benign Het
Sclt1 A G 3: 41,629,516 probably null Het
Serpinb1a G T 13: 32,842,866 H364Q probably damaging Het
Sez6l G A 5: 112,475,365 Q107* probably null Het
Sipa1l2 C T 8: 125,469,872 V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Uaca T A 9: 60,850,291 probably null Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Usp9y C T Y: 1,316,735 R1938H probably damaging Homo
Wnk4 C T 11: 101,265,431 R42W probably damaging Het
Zfp326 T A 5: 105,905,980 L242Q probably damaging Het
Other mutations in Olfr1329
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Olfr1329 APN 4 118916894 missense possibly damaging 0.67
IGL02065:Olfr1329 APN 4 118916771 missense probably benign 0.00
IGL02085:Olfr1329 APN 4 118916750 missense probably damaging 1.00
IGL02092:Olfr1329 APN 4 118916990 missense possibly damaging 0.72
IGL02557:Olfr1329 APN 4 118917192 missense probably benign 0.00
R0129:Olfr1329 UTSW 4 118917470 splice site probably null
R0411:Olfr1329 UTSW 4 118916626 missense possibly damaging 0.87
R5001:Olfr1329 UTSW 4 118917243 missense probably damaging 0.97
R5313:Olfr1329 UTSW 4 118916798 missense probably benign 0.00
R5733:Olfr1329 UTSW 4 118916838 missense probably benign 0.00
R6153:Olfr1329 UTSW 4 118916747 missense probably damaging 1.00
R7671:Olfr1329 UTSW 4 118916986 missense probably benign 0.02
R8358:Olfr1329 UTSW 4 118916526 makesense probably null
Z1088:Olfr1329 UTSW 4 118916588 missense probably damaging 1.00
Z1176:Olfr1329 UTSW 4 118917027 missense probably benign 0.21
Z1176:Olfr1329 UTSW 4 118917135 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGACAGTATAGCGCAATGGATAGC -3'
(R):5'- TCCAGGGCAGAACCAAAGTTG -3'

Sequencing Primer
(F):5'- TGGATAGCAAATAGCCACATACCG -3'
(R):5'- CCAAAGTTGGGTTTCTGAGTTCATCC -3'
Posted On2018-03-15