Mutagenetix > Incidental Mutation

Incidental Mutation 'R6274:Olfr1329'

507513

Institutional Source

Beutler Lab

Gene Symbol

Olfr1329

Ensembl Gene

ENSMUSG00000096705

Gene Name

olfactory receptor 1329

Synonyms

MOR259-2, GA_x6K02T2QD9B-18619941-18620882

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.131) question?

Stock #

R6274 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118916524-118917465 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 118917230 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 79 (V79E)

Ref Sequence

ENSEMBL: ENSMUSP00000071870 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071979]

AlphaFold

L7MTV4

Predicted Effect

probably benign
Transcript: ENSMUST00000071979
AA Change: V79E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000071870
Gene: ENSMUSG00000096705
AA Change: V79E

Domain	Start	End	E-Value	Type
Pfam:7tm_4	32	308	4.3e-55	PFAM
Pfam:7TM_GPCR_Srsx	36	306	1.5e-6	PFAM
Pfam:7tm_1	42	291	5.7e-25	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.1%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ano1	A	T	7: 144,618,863	S528T	probably benign	Het
Araf	G	T	X: 20,860,100	R601L	probably damaging	Homo
Bcl2l10	T	C	9: 75,351,072	I172T	possibly damaging	Het
Bpifb3	A	T	2: 153,929,323	N385I	possibly damaging	Het
Bsnd	A	G	4: 106,486,635	V158A	probably damaging	Het
Cacna1s	A	G	1: 136,089,045	N481S	probably benign	Het
Cdk5rap1	A	G	2: 154,368,241	V138A	probably damaging	Het
Cep290	A	G	10: 100,530,207	E1099G	probably damaging	Het
Cers1	T	A	8: 70,331,077	L225Q	probably damaging	Het
Cfb	T	C	17: 34,862,093	Q7R	probably benign	Het
Clk4	A	G	11: 51,271,921	S98G	possibly damaging	Het
Clock	A	G	5: 76,237,153	S406P	probably benign	Het
Csmd3	T	C	15: 47,621,437	I3178V	probably benign	Het
Dock10	A	G	1: 80,538,823	S1397P	probably damaging	Het
Fer1l4	A	G	2: 156,029,268	L1421P	probably damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Greb1	G	T	12: 16,735,151	T91K	probably damaging	Het
Grid2ip	G	A	5: 143,380,429	S379N	probably damaging	Het
Gucy1b2	A	T	14: 62,415,939	C336S	probably damaging	Het
Hdac1	A	G	4: 129,519,109	C261R	probably damaging	Het
Hrasls5	C	T	19: 7,637,466	T231I	probably damaging	Het
Htt	T	C	5: 34,852,087	S1471P	possibly damaging	Het
Ice1	A	G	13: 70,594,839	V2134A	probably damaging	Het
Ikzf1	C	T	11: 11,768,961	Q310*	probably null	Het
Il3ra	G	A	14: 14,350,180	V112I	probably benign	Het
Kif21b	A	G	1: 136,149,418	I393V	possibly damaging	Het
Krt74	T	C	15: 101,763,437		noncoding transcript	Het
Krtap29-1	T	C	11: 99,978,983	N24S	probably null	Het
Mut	T	C	17: 40,956,245	V570A	probably benign	Het
Myh7	T	C	14: 54,979,486	D1138G	probably damaging	Het
Nktr	T	C	9: 121,731,565	I125T	probably damaging	Het
Nlrp2	A	T	7: 5,317,555	L861Q	probably damaging	Het
Notch3	C	A	17: 32,147,290	R990L	probably benign	Het
Nrap	T	C	19: 56,361,721	D655G	probably benign	Het
Olfr1451	G	A	19: 12,999,870	V295I	probably damaging	Het
Osbpl11	T	A	16: 33,227,056	I463N	probably damaging	Het
Pcsk6	A	T	7: 66,033,844	R749W	probably damaging	Het
Plxnb1	T	C	9: 109,112,141		probably null	Het
Polr1a	T	A	6: 71,954,890		probably null	Het
Ppm1g	T	C	5: 31,206,406	I153V	probably damaging	Het
Ppp1r12a	T	C	10: 108,260,890	S191P	probably benign	Het
Prodh	T	C	16: 18,081,058	K178E	possibly damaging	Het
Rilpl2	A	G	5: 124,469,848	V103A	possibly damaging	Het
Sap18b	C	T	8: 95,825,541	H60Y	probably benign	Het
Sclt1	A	G	3: 41,629,516		probably null	Het
Serpinb1a	G	T	13: 32,842,866	H364Q	probably damaging	Het
Sez6l	G	A	5: 112,475,365	Q107*	probably null	Het
Sipa1l2	C	T	8: 125,469,872	V708I	probably damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Uaca	T	A	9: 60,850,291		probably null	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Usp9y	C	T	Y: 1,316,735	R1938H	probably damaging	Homo
Wnk4	C	T	11: 101,265,431	R42W	probably damaging	Het
Zfp326	T	A	5: 105,905,980	L242Q	probably damaging	Het

Other mutations in Olfr1329

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01064:Olfr1329	APN	4	118916894	missense	possibly damaging	0.67
IGL02065:Olfr1329	APN	4	118916771	missense	probably benign	0.00
IGL02085:Olfr1329	APN	4	118916750	missense	probably damaging	1.00
IGL02092:Olfr1329	APN	4	118916990	missense	possibly damaging	0.72
IGL02557:Olfr1329	APN	4	118917192	missense	probably benign	0.00
R0129:Olfr1329	UTSW	4	118917470	splice site	probably null
R0411:Olfr1329	UTSW	4	118916626	missense	possibly damaging	0.87
R5001:Olfr1329	UTSW	4	118917243	missense	probably damaging	0.97
R5313:Olfr1329	UTSW	4	118916798	missense	probably benign	0.00
R5733:Olfr1329	UTSW	4	118916838	missense	probably benign	0.00
R6153:Olfr1329	UTSW	4	118916747	missense	probably damaging	1.00
R7671:Olfr1329	UTSW	4	118916986	missense	probably benign	0.02
R8358:Olfr1329	UTSW	4	118916526	makesense	probably null
R8696:Olfr1329	UTSW	4	118917438	missense	probably benign	0.23
R8881:Olfr1329	UTSW	4	118917374	missense	probably benign	0.01
R9599:Olfr1329	UTSW	4	118916654	missense	probably benign	0.00
R9655:Olfr1329	UTSW	4	118916607	missense	probably damaging	1.00
Z1088:Olfr1329	UTSW	4	118916588	missense	probably damaging	1.00
Z1176:Olfr1329	UTSW	4	118917027	missense	probably benign	0.21
Z1176:Olfr1329	UTSW	4	118917135	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TGACAGTATAGCGCAATGGATAGC -3'
(R):5'- TCCAGGGCAGAACCAAAGTTG -3'

Sequencing Primer
(F):5'- TGGATAGCAAATAGCCACATACCG -3'
(R):5'- CCAAAGTTGGGTTTCTGAGTTCATCC -3'

Posted On

2018-03-15