Incidental Mutation 'R6274:Or10ak8'
ID 507513
Institutional Source Beutler Lab
Gene Symbol Or10ak8
Ensembl Gene ENSMUSG00000096705
Gene Name olfactory receptor family 10 subfamily AK member 8
Synonyms Olfr1329, MOR259-2, GA_x6K02T2QD9B-18619941-18620882
MMRRC Submission 044444-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.140) question?
Stock # R6274 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 118773721-118774662 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 118774427 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 79 (V79E)
Ref Sequence ENSEMBL: ENSMUSP00000071870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071979]
AlphaFold L7MTV4
Predicted Effect probably benign
Transcript: ENSMUST00000071979
AA Change: V79E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000071870
Gene: ENSMUSG00000096705
AA Change: V79E

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 4.3e-55 PFAM
Pfam:7TM_GPCR_Srsx 36 306 1.5e-6 PFAM
Pfam:7tm_1 42 291 5.7e-25 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Ano1 A T 7: 144,172,600 (GRCm39) S528T probably benign Het
Araf G T X: 20,726,339 (GRCm39) R601L probably damaging Homo
Bcl2l10 T C 9: 75,258,354 (GRCm39) I172T possibly damaging Het
Bpifb3 A T 2: 153,771,243 (GRCm39) N385I possibly damaging Het
Bsnd A G 4: 106,343,832 (GRCm39) V158A probably damaging Het
Cacna1s A G 1: 136,016,783 (GRCm39) N481S probably benign Het
Cdk5rap1 A G 2: 154,210,161 (GRCm39) V138A probably damaging Het
Cep290 A G 10: 100,366,069 (GRCm39) E1099G probably damaging Het
Cers1 T A 8: 70,783,727 (GRCm39) L225Q probably damaging Het
Cfb T C 17: 35,081,069 (GRCm39) Q7R probably benign Het
Clk4 A G 11: 51,162,748 (GRCm39) S98G possibly damaging Het
Clock A G 5: 76,385,000 (GRCm39) S406P probably benign Het
Csmd3 T C 15: 47,484,833 (GRCm39) I3178V probably benign Het
Dock10 A G 1: 80,516,540 (GRCm39) S1397P probably damaging Het
Fer1l4 A G 2: 155,871,188 (GRCm39) L1421P probably damaging Het
Fetub C T 16: 22,751,081 (GRCm39) R143C probably damaging Het
Greb1 G T 12: 16,785,152 (GRCm39) T91K probably damaging Het
Grid2ip G A 5: 143,366,184 (GRCm39) S379N probably damaging Het
Gucy1b2 A T 14: 62,653,388 (GRCm39) C336S probably damaging Het
Hdac1 A G 4: 129,412,902 (GRCm39) C261R probably damaging Het
Htt T C 5: 35,009,431 (GRCm39) S1471P possibly damaging Het
Ice1 A G 13: 70,742,958 (GRCm39) V2134A probably damaging Het
Ikzf1 C T 11: 11,718,961 (GRCm39) Q310* probably null Het
Il3ra G A 14: 14,350,180 (GRCm38) V112I probably benign Het
Kif21b A G 1: 136,077,156 (GRCm39) I393V possibly damaging Het
Krt74 T C 15: 101,671,872 (GRCm39) noncoding transcript Het
Krtap29-1 T C 11: 99,869,809 (GRCm39) N24S probably null Het
Mmut T C 17: 41,267,136 (GRCm39) V570A probably benign Het
Myh7 T C 14: 55,216,943 (GRCm39) D1138G probably damaging Het
Nktr T C 9: 121,560,631 (GRCm39) I125T probably damaging Het
Nlrp2 A T 7: 5,320,554 (GRCm39) L861Q probably damaging Het
Notch3 C A 17: 32,366,264 (GRCm39) R990L probably benign Het
Nrap T C 19: 56,350,153 (GRCm39) D655G probably benign Het
Or5b99 G A 19: 12,977,234 (GRCm39) V295I probably damaging Het
Osbpl11 T A 16: 33,047,426 (GRCm39) I463N probably damaging Het
Pcsk6 A T 7: 65,683,592 (GRCm39) R749W probably damaging Het
Plaat5 C T 19: 7,614,831 (GRCm39) T231I probably damaging Het
Plxnb1 T C 9: 108,941,209 (GRCm39) probably null Het
Polr1a T A 6: 71,931,874 (GRCm39) probably null Het
Ppm1g T C 5: 31,363,750 (GRCm39) I153V probably damaging Het
Ppp1r12a T C 10: 108,096,751 (GRCm39) S191P probably benign Het
Prodh T C 16: 17,898,922 (GRCm39) K178E possibly damaging Het
Rilpl2 A G 5: 124,607,911 (GRCm39) V103A possibly damaging Het
Sap18b C T 8: 96,552,169 (GRCm39) H60Y probably benign Het
Sclt1 A G 3: 41,583,951 (GRCm39) probably null Het
Serpinb1a G T 13: 33,026,849 (GRCm39) H364Q probably damaging Het
Sez6l G A 5: 112,623,231 (GRCm39) Q107* probably null Het
Sipa1l2 C T 8: 126,196,611 (GRCm39) V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 (GRCm39) G252R probably benign Het
Uaca T A 9: 60,757,573 (GRCm39) probably null Het
Uqcrc1 C A 9: 108,771,224 (GRCm39) H95N probably damaging Het
Usp9y C T Y: 1,316,735 (GRCm39) R1938H probably damaging Homo
Wnk4 C T 11: 101,156,257 (GRCm39) R42W probably damaging Het
Zfp326 T A 5: 106,053,846 (GRCm39) L242Q probably damaging Het
Other mutations in Or10ak8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Or10ak8 APN 4 118,774,091 (GRCm39) missense possibly damaging 0.67
IGL02065:Or10ak8 APN 4 118,773,968 (GRCm39) missense probably benign 0.00
IGL02085:Or10ak8 APN 4 118,773,947 (GRCm39) missense probably damaging 1.00
IGL02092:Or10ak8 APN 4 118,774,187 (GRCm39) missense possibly damaging 0.72
IGL02557:Or10ak8 APN 4 118,774,389 (GRCm39) missense probably benign 0.00
R0129:Or10ak8 UTSW 4 118,774,667 (GRCm39) splice site probably null
R0411:Or10ak8 UTSW 4 118,773,823 (GRCm39) missense possibly damaging 0.87
R5001:Or10ak8 UTSW 4 118,774,440 (GRCm39) missense probably damaging 0.97
R5313:Or10ak8 UTSW 4 118,773,995 (GRCm39) missense probably benign 0.00
R5733:Or10ak8 UTSW 4 118,774,035 (GRCm39) missense probably benign 0.00
R6153:Or10ak8 UTSW 4 118,773,944 (GRCm39) missense probably damaging 1.00
R7671:Or10ak8 UTSW 4 118,774,183 (GRCm39) missense probably benign 0.02
R8358:Or10ak8 UTSW 4 118,773,723 (GRCm39) makesense probably null
R8696:Or10ak8 UTSW 4 118,774,635 (GRCm39) missense probably benign 0.23
R8881:Or10ak8 UTSW 4 118,774,571 (GRCm39) missense probably benign 0.01
R9599:Or10ak8 UTSW 4 118,773,851 (GRCm39) missense probably benign 0.00
R9655:Or10ak8 UTSW 4 118,773,804 (GRCm39) missense probably damaging 1.00
Z1088:Or10ak8 UTSW 4 118,773,785 (GRCm39) missense probably damaging 1.00
Z1176:Or10ak8 UTSW 4 118,774,332 (GRCm39) missense probably damaging 0.96
Z1176:Or10ak8 UTSW 4 118,774,224 (GRCm39) missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TGACAGTATAGCGCAATGGATAGC -3'
(R):5'- TCCAGGGCAGAACCAAAGTTG -3'

Sequencing Primer
(F):5'- TGGATAGCAAATAGCCACATACCG -3'
(R):5'- CCAAAGTTGGGTTTCTGAGTTCATCC -3'
Posted On 2018-03-15