Incidental Mutation 'R6274:Ppm1g'
ID507515
Institutional Source Beutler Lab
Gene Symbol Ppm1g
Ensembl Gene ENSMUSG00000029147
Gene Nameprotein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform
SynonymsFin13
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6274 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location31202664-31220687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31206406 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 153 (I153V)
Ref Sequence ENSEMBL: ENSMUSP00000031032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031032] [ENSMUST00000031562] [ENSMUST00000114590] [ENSMUST00000201231] [ENSMUST00000201407] [ENSMUST00000202294] [ENSMUST00000202929]
Predicted Effect probably damaging
Transcript: ENSMUST00000031032
AA Change: I153V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031032
Gene: ENSMUSG00000029147
AA Change: I153V

DomainStartEndE-ValueType
PP2Cc 15 500 9.7e-103 SMART
PP2C_SIG 219 502 1.05e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000031562
SMART Domains Protein: ENSMUSP00000031562
Gene: ENSMUSG00000043059

DomainStartEndE-ValueType
low complexity region 35 55 N/A INTRINSIC
low complexity region 100 117 N/A INTRINSIC
low complexity region 121 144 N/A INTRINSIC
ZnF_C2H2 148 170 1.33e-1 SMART
ZnF_C2H2 176 198 2.86e-1 SMART
ZnF_C2H2 204 226 1.06e-4 SMART
low complexity region 227 238 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
ZnF_C2H2 358 380 1.03e-2 SMART
ZnF_C2H2 386 408 5.42e-2 SMART
ZnF_C2H2 414 436 2.91e-2 SMART
ZnF_C2H2 442 464 1.38e-3 SMART
ZnF_C2H2 470 492 5.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114590
SMART Domains Protein: ENSMUSP00000110238
Gene: ENSMUSG00000043059

DomainStartEndE-ValueType
low complexity region 37 57 N/A INTRINSIC
low complexity region 102 119 N/A INTRINSIC
low complexity region 123 146 N/A INTRINSIC
ZnF_C2H2 150 172 1.33e-1 SMART
ZnF_C2H2 178 200 2.86e-1 SMART
ZnF_C2H2 206 228 1.06e-4 SMART
low complexity region 229 240 N/A INTRINSIC
low complexity region 342 356 N/A INTRINSIC
ZnF_C2H2 360 382 1.03e-2 SMART
ZnF_C2H2 388 410 5.42e-2 SMART
ZnF_C2H2 416 438 2.91e-2 SMART
ZnF_C2H2 444 466 1.38e-3 SMART
ZnF_C2H2 472 494 5.06e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000200778
AA Change: I94V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200853
Predicted Effect probably benign
Transcript: ENSMUST00000201231
SMART Domains Protein: ENSMUSP00000144172
Gene: ENSMUSG00000043059

DomainStartEndE-ValueType
low complexity region 35 55 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000201407
AA Change: I51V

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144556
Gene: ENSMUSG00000029147
AA Change: I51V

DomainStartEndE-ValueType
Blast:PP2Cc 1 155 4e-87 BLAST
low complexity region 156 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202294
SMART Domains Protein: ENSMUSP00000144644
Gene: ENSMUSG00000029147

DomainStartEndE-ValueType
PP2Cc 15 393 6.6e-105 SMART
PP2C_SIG 38 395 3.7e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202402
Predicted Effect probably benign
Transcript: ENSMUST00000202929
SMART Domains Protein: ENSMUSP00000143817
Gene: ENSMUSG00000043059

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase is found to be responsible for the dephosphorylation of Pre-mRNA splicing factors, which is important for the formation of functional spliceosome. Studies of a similar gene in mice suggested a role of this phosphatase in regulating cell cycle progression. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a targeted mutation display perinatal lethality. Mice heterozygous for a targeted mutation display a decrease in prepulse inhibition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ano1 A T 7: 144,618,863 S528T probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Bcl2l10 T C 9: 75,351,072 I172T possibly damaging Het
Bpifb3 A T 2: 153,929,323 N385I possibly damaging Het
Bsnd A G 4: 106,486,635 V158A probably damaging Het
Cacna1s A G 1: 136,089,045 N481S probably benign Het
Cdk5rap1 A G 2: 154,368,241 V138A probably damaging Het
Cep290 A G 10: 100,530,207 E1099G probably damaging Het
Cers1 T A 8: 70,331,077 L225Q probably damaging Het
Cfb T C 17: 34,862,093 Q7R probably benign Het
Clk4 A G 11: 51,271,921 S98G possibly damaging Het
Clock A G 5: 76,237,153 S406P probably benign Het
Csmd3 T C 15: 47,621,437 I3178V probably benign Het
Dock10 A G 1: 80,538,823 S1397P probably damaging Het
Fer1l4 A G 2: 156,029,268 L1421P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Greb1 G T 12: 16,735,151 T91K probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
Gucy1b2 A T 14: 62,415,939 C336S probably damaging Het
Hdac1 A G 4: 129,519,109 C261R probably damaging Het
Hrasls5 C T 19: 7,637,466 T231I probably damaging Het
Htt T C 5: 34,852,087 S1471P possibly damaging Het
Ice1 A G 13: 70,594,839 V2134A probably damaging Het
Ikzf1 C T 11: 11,768,961 Q310* probably null Het
Il3ra G A 14: 14,350,180 V112I probably benign Het
Kif21b A G 1: 136,149,418 I393V possibly damaging Het
Krt74 T C 15: 101,763,437 noncoding transcript Het
Krtap29-1 T C 11: 99,978,983 N24S probably null Het
Mut T C 17: 40,956,245 V570A probably benign Het
Myh7 T C 14: 54,979,486 D1138G probably damaging Het
Nktr T C 9: 121,731,565 I125T probably damaging Het
Nlrp2 A T 7: 5,317,555 L861Q probably damaging Het
Notch3 C A 17: 32,147,290 R990L probably benign Het
Nrap T C 19: 56,361,721 D655G probably benign Het
Olfr1329 A T 4: 118,917,230 V79E probably benign Het
Olfr1451 G A 19: 12,999,870 V295I probably damaging Het
Osbpl11 T A 16: 33,227,056 I463N probably damaging Het
Pcsk6 A T 7: 66,033,844 R749W probably damaging Het
Plxnb1 T C 9: 109,112,141 probably null Het
Polr1a T A 6: 71,954,890 probably null Het
Ppp1r12a T C 10: 108,260,890 S191P probably benign Het
Prodh T C 16: 18,081,058 K178E possibly damaging Het
Rilpl2 A G 5: 124,469,848 V103A possibly damaging Het
Sap18b C T 8: 95,825,541 H60Y probably benign Het
Sclt1 A G 3: 41,629,516 probably null Het
Serpinb1a G T 13: 32,842,866 H364Q probably damaging Het
Sez6l G A 5: 112,475,365 Q107* probably null Het
Sipa1l2 C T 8: 125,469,872 V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Uaca T A 9: 60,850,291 probably null Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Usp9y C T Y: 1,316,735 R1938H probably damaging Homo
Wnk4 C T 11: 101,265,431 R42W probably damaging Het
Zfp326 T A 5: 105,905,980 L242Q probably damaging Het
Other mutations in Ppm1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02517:Ppm1g APN 5 31208081 missense probably damaging 1.00
R0843:Ppm1g UTSW 5 31207551 splice site probably benign
R1483:Ppm1g UTSW 5 31203121 missense probably benign 0.45
R1750:Ppm1g UTSW 5 31206216 missense probably damaging 1.00
R5611:Ppm1g UTSW 5 31206097 missense probably damaging 1.00
R5776:Ppm1g UTSW 5 31205110 missense probably benign 0.01
R6450:Ppm1g UTSW 5 31203124 missense probably benign 0.01
R7360:Ppm1g UTSW 5 31203277 missense probably damaging 1.00
R7642:Ppm1g UTSW 5 31205103 nonsense probably null
R8508:Ppm1g UTSW 5 31204528 missense probably damaging 1.00
Z1176:Ppm1g UTSW 5 31220436 start gained probably benign
Z1177:Ppm1g UTSW 5 31220314 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTTGGCCTGCCTCAGTCC -3'
(R):5'- TCAGACTCGAATAGTGAGGAGC -3'

Sequencing Primer
(F):5'- CAGTCCCATGTTCCGAGTTGG -3'
(R):5'- GCCTCAGAGGTAGAAGGTAATG -3'
Posted On2018-03-15