Incidental Mutation 'R6274:Clock'
ID 507517
Institutional Source Beutler Lab
Gene Symbol Clock
Ensembl Gene ENSMUSG00000029238
Gene Name circadian locomotor output cycles kaput
Synonyms 5330400M04Rik, bHLHe8, KAT13D
MMRRC Submission 044444-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.688) question?
Stock # R6274 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 76209868-76304792 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 76237153 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 406 (S406P)
Ref Sequence ENSEMBL: ENSMUSP00000143939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075159] [ENSMUST00000202122] [ENSMUST00000202651]
AlphaFold O08785
Predicted Effect probably benign
Transcript: ENSMUST00000075159
AA Change: S406P

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074656
Gene: ENSMUSG00000029238
AA Change: S406P

DomainStartEndE-ValueType
HLH 40 90 7.77e-12 SMART
PAS 109 175 1.88e-6 SMART
PAS 264 330 3.65e-4 SMART
PAC 336 379 7.63e-7 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
low complexity region 640 657 N/A INTRINSIC
low complexity region 738 796 N/A INTRINSIC
low complexity region 818 837 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201768
Predicted Effect probably benign
Transcript: ENSMUST00000202122
AA Change: S406P

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144022
Gene: ENSMUSG00000029238
AA Change: S406P

DomainStartEndE-ValueType
TFS2N 34 106 4.1e-3 SMART
HLH 40 90 3.4e-14 SMART
PAS 109 175 9.6e-9 SMART
PAS 264 330 1.8e-6 SMART
PAC 336 379 3.9e-9 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 633 N/A INTRINSIC
low complexity region 639 656 N/A INTRINSIC
low complexity region 737 795 N/A INTRINSIC
low complexity region 817 836 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202651
AA Change: S406P

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143939
Gene: ENSMUSG00000029238
AA Change: S406P

DomainStartEndE-ValueType
HLH 40 90 7.77e-12 SMART
PAS 109 175 1.88e-6 SMART
PAS 264 330 3.65e-4 SMART
PAC 336 379 7.63e-7 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
low complexity region 640 657 N/A INTRINSIC
low complexity region 738 796 N/A INTRINSIC
low complexity region 818 837 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202857
Meta Mutation Damage Score 0.0731 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: The protein encoded by this gene plays a central role in the regulation of circadian rhythms. The protein encodes a transcription factor of the basic helix-loop-helix (bHLH) family and contains DNA binding histone acetyltransferase activity. The encoded protein forms a heterodimer with Arntl (Bmal1) that binds E-box enhancer elements upstream of Period (Per1, Per2, Per3) and Cryptochrome (Cry1, Cry2) genes and activates transcription of these genes. Per and Cry proteins heterodimerize and repress their own transcription by interacting in a feedback loop with Clock/Arntl complexes. Polymorphisms in this gene may be associated with behavioral changes, obesity, and metabolic syndrome. Two transcripts encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal circadian phase. Mice homozygous for a spontaneous mutation exhibit abnormal circadian rhythm, reproduction, behavior, hair cycle, macronutrient absorption, and metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ano1 A T 7: 144,618,863 S528T probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Bcl2l10 T C 9: 75,351,072 I172T possibly damaging Het
Bpifb3 A T 2: 153,929,323 N385I possibly damaging Het
Bsnd A G 4: 106,486,635 V158A probably damaging Het
Cacna1s A G 1: 136,089,045 N481S probably benign Het
Cdk5rap1 A G 2: 154,368,241 V138A probably damaging Het
Cep290 A G 10: 100,530,207 E1099G probably damaging Het
Cers1 T A 8: 70,331,077 L225Q probably damaging Het
Cfb T C 17: 34,862,093 Q7R probably benign Het
Clk4 A G 11: 51,271,921 S98G possibly damaging Het
Csmd3 T C 15: 47,621,437 I3178V probably benign Het
Dock10 A G 1: 80,538,823 S1397P probably damaging Het
Fer1l4 A G 2: 156,029,268 L1421P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Greb1 G T 12: 16,735,151 T91K probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
Gucy1b2 A T 14: 62,415,939 C336S probably damaging Het
Hdac1 A G 4: 129,519,109 C261R probably damaging Het
Hrasls5 C T 19: 7,637,466 T231I probably damaging Het
Htt T C 5: 34,852,087 S1471P possibly damaging Het
Ice1 A G 13: 70,594,839 V2134A probably damaging Het
Ikzf1 C T 11: 11,768,961 Q310* probably null Het
Il3ra G A 14: 14,350,180 V112I probably benign Het
Kif21b A G 1: 136,149,418 I393V possibly damaging Het
Krt74 T C 15: 101,763,437 noncoding transcript Het
Krtap29-1 T C 11: 99,978,983 N24S probably null Het
Mut T C 17: 40,956,245 V570A probably benign Het
Myh7 T C 14: 54,979,486 D1138G probably damaging Het
Nktr T C 9: 121,731,565 I125T probably damaging Het
Nlrp2 A T 7: 5,317,555 L861Q probably damaging Het
Notch3 C A 17: 32,147,290 R990L probably benign Het
Nrap T C 19: 56,361,721 D655G probably benign Het
Olfr1329 A T 4: 118,917,230 V79E probably benign Het
Olfr1451 G A 19: 12,999,870 V295I probably damaging Het
Osbpl11 T A 16: 33,227,056 I463N probably damaging Het
Pcsk6 A T 7: 66,033,844 R749W probably damaging Het
Plxnb1 T C 9: 109,112,141 probably null Het
Polr1a T A 6: 71,954,890 probably null Het
Ppm1g T C 5: 31,206,406 I153V probably damaging Het
Ppp1r12a T C 10: 108,260,890 S191P probably benign Het
Prodh T C 16: 18,081,058 K178E possibly damaging Het
Rilpl2 A G 5: 124,469,848 V103A possibly damaging Het
Sap18b C T 8: 95,825,541 H60Y probably benign Het
Sclt1 A G 3: 41,629,516 probably null Het
Serpinb1a G T 13: 32,842,866 H364Q probably damaging Het
Sez6l G A 5: 112,475,365 Q107* probably null Het
Sipa1l2 C T 8: 125,469,872 V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Uaca T A 9: 60,850,291 probably null Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Usp9y C T Y: 1,316,735 R1938H probably damaging Homo
Wnk4 C T 11: 101,265,431 R42W probably damaging Het
Zfp326 T A 5: 105,905,980 L242Q probably damaging Het
Other mutations in Clock
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Clock APN 5 76229464 missense probably benign 0.17
IGL00725:Clock APN 5 76254413 nonsense probably null
IGL01304:Clock APN 5 76266355 critical splice donor site probably null
IGL01369:Clock APN 5 76237086 missense probably benign 0.30
IGL01542:Clock APN 5 76231475 missense possibly damaging 0.82
IGL02541:Clock APN 5 76262672 splice site probably null
IGL02602:Clock APN 5 76254426 missense probably null 1.00
IGL02602:Clock APN 5 76254427 missense probably damaging 1.00
IGL03186:Clock APN 5 76243082 missense probably damaging 0.98
IGL03309:Clock APN 5 76231394 critical splice donor site probably null
R6760_Clock_188 UTSW 5 76226976 missense unknown
uhr UTSW 5 76229554 nonsense probably null
R0304:Clock UTSW 5 76226985 missense unknown
R0593:Clock UTSW 5 76265836 missense probably benign 0.25
R0654:Clock UTSW 5 76227129 missense possibly damaging 0.95
R0684:Clock UTSW 5 76245518 missense probably damaging 0.96
R0707:Clock UTSW 5 76227129 missense possibly damaging 0.95
R0751:Clock UTSW 5 76229361 missense possibly damaging 0.75
R0865:Clock UTSW 5 76266424 splice site probably benign
R0920:Clock UTSW 5 76230320 missense possibly damaging 0.80
R1396:Clock UTSW 5 76266802 missense probably benign 0.00
R1450:Clock UTSW 5 76262731 nonsense probably null
R1487:Clock UTSW 5 76266354 splice site probably null
R1574:Clock UTSW 5 76242832 missense probably damaging 1.00
R1574:Clock UTSW 5 76242832 missense probably damaging 1.00
R1858:Clock UTSW 5 76240909 missense possibly damaging 0.92
R1872:Clock UTSW 5 76248462 missense possibly damaging 0.67
R1905:Clock UTSW 5 76266888 splice site probably benign
R1937:Clock UTSW 5 76229493 missense probably damaging 0.99
R2411:Clock UTSW 5 76231513 missense probably benign 0.08
R2887:Clock UTSW 5 76245273 missense probably damaging 0.99
R3410:Clock UTSW 5 76229554 nonsense probably null
R4514:Clock UTSW 5 76230199 missense probably benign 0.00
R4598:Clock UTSW 5 76235810 missense probably benign 0.00
R4599:Clock UTSW 5 76235810 missense probably benign 0.00
R4795:Clock UTSW 5 76265916 missense probably damaging 1.00
R4796:Clock UTSW 5 76265916 missense probably damaging 1.00
R4973:Clock UTSW 5 76254411 missense possibly damaging 0.62
R5204:Clock UTSW 5 76243170 splice site probably null
R5271:Clock UTSW 5 76241954 missense probably damaging 1.00
R5547:Clock UTSW 5 76230338 missense probably benign 0.02
R5630:Clock UTSW 5 76230338 missense probably benign 0.02
R5631:Clock UTSW 5 76230338 missense probably benign 0.02
R5632:Clock UTSW 5 76230338 missense probably benign 0.02
R5787:Clock UTSW 5 76237051 missense probably damaging 1.00
R6578:Clock UTSW 5 76216709 missense unknown
R6622:Clock UTSW 5 76241954 missense probably damaging 1.00
R6760:Clock UTSW 5 76226976 missense unknown
R6793:Clock UTSW 5 76237120 frame shift probably null
R7406:Clock UTSW 5 76266845 start codon destroyed probably null 0.26
R7414:Clock UTSW 5 76262764 missense probably benign 0.00
R7560:Clock UTSW 5 76242891 splice site probably null
R7593:Clock UTSW 5 76236298 missense possibly damaging 0.80
R7640:Clock UTSW 5 76248378 missense possibly damaging 0.71
R7708:Clock UTSW 5 76266409 missense probably benign 0.00
R7713:Clock UTSW 5 76245420 critical splice donor site probably null
R7807:Clock UTSW 5 76243135 missense probably benign 0.01
R8171:Clock UTSW 5 76266414 missense possibly damaging 0.94
R8190:Clock UTSW 5 76227204 missense probably damaging 0.98
R8225:Clock UTSW 5 76241912 missense probably damaging 0.99
R8309:Clock UTSW 5 76254422 missense probably benign 0.07
R8557:Clock UTSW 5 76229370 missense probably damaging 1.00
R8792:Clock UTSW 5 76262727 missense probably damaging 1.00
R8869:Clock UTSW 5 76227042 small deletion probably benign
R8870:Clock UTSW 5 76235785 missense probably benign 0.17
R8980:Clock UTSW 5 76254439 missense probably benign 0.01
R8982:Clock UTSW 5 76216712 missense unknown
R9177:Clock UTSW 5 76229409 missense probably benign 0.00
R9208:Clock UTSW 5 76237024 missense probably benign 0.00
R9213:Clock UTSW 5 76245529 missense possibly damaging 0.94
R9307:Clock UTSW 5 76216824 missense unknown
R9446:Clock UTSW 5 76248441 missense probably benign 0.00
R9516:Clock UTSW 5 76229380 missense possibly damaging 0.85
R9572:Clock UTSW 5 76229491 missense probably benign 0.00
R9630:Clock UTSW 5 76245434 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGACCTCTTTGAAACATGCTTG -3'
(R):5'- ACATGCAATGTGTCTGTTTCC -3'

Sequencing Primer
(F):5'- AACATGCTTGTTTTCAGCTGAGGC -3'
(R):5'- CCATCTTGCCACAAAAGTTTTGGG -3'
Posted On 2018-03-15