Mutagenetix > Incidental Mutations

Incidental Mutation 'R6274:Clock'

507517

Institutional Source

Beutler Lab

Gene Symbol

Clock

Ensembl Gene

ENSMUSG00000029238

Gene Name

circadian locomotor output cycles kaput

Synonyms

5330400M04Rik, bHLHe8, KAT13D

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.824) question?

Stock #

R6274 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76209868-76304792 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 76237153 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 406 (S406P)

Ref Sequence

ENSEMBL: ENSMUSP00000143939 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075159] [ENSMUST00000202122] [ENSMUST00000202651]

AlphaFold

O08785

Predicted Effect

probably benign
Transcript: ENSMUST00000075159
AA Change: S406P

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000074656
Gene: ENSMUSG00000029238
AA Change: S406P

Domain	Start	End	E-Value	Type
HLH	40	90	7.77e-12	SMART
PAS	109	175	1.88e-6	SMART
PAS	264	330	3.65e-4	SMART
PAC	336	379	7.63e-7	SMART
low complexity region	426	446	N/A	INTRINSIC
low complexity region	478	493	N/A	INTRINSIC
coiled coil region	523	559	N/A	INTRINSIC
low complexity region	619	634	N/A	INTRINSIC
low complexity region	640	657	N/A	INTRINSIC
low complexity region	738	796	N/A	INTRINSIC
low complexity region	818	837	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201768

Predicted Effect

probably benign
Transcript: ENSMUST00000202122
AA Change: S406P

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000144022
Gene: ENSMUSG00000029238
AA Change: S406P

Domain	Start	End	E-Value	Type
TFS2N	34	106	4.1e-3	SMART
HLH	40	90	3.4e-14	SMART
PAS	109	175	9.6e-9	SMART
PAS	264	330	1.8e-6	SMART
PAC	336	379	3.9e-9	SMART
low complexity region	426	446	N/A	INTRINSIC
low complexity region	478	493	N/A	INTRINSIC
coiled coil region	523	559	N/A	INTRINSIC
low complexity region	619	633	N/A	INTRINSIC
low complexity region	639	656	N/A	INTRINSIC
low complexity region	737	795	N/A	INTRINSIC
low complexity region	817	836	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202651
AA Change: S406P

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000143939
Gene: ENSMUSG00000029238
AA Change: S406P

Domain	Start	End	E-Value	Type
HLH	40	90	7.77e-12	SMART
PAS	109	175	1.88e-6	SMART
PAS	264	330	3.65e-4	SMART
PAC	336	379	7.63e-7	SMART
low complexity region	426	446	N/A	INTRINSIC
low complexity region	478	493	N/A	INTRINSIC
coiled coil region	523	559	N/A	INTRINSIC
low complexity region	619	634	N/A	INTRINSIC
low complexity region	640	657	N/A	INTRINSIC
low complexity region	738	796	N/A	INTRINSIC
low complexity region	818	837	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202857

Meta Mutation Damage Score

0.0731

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.1%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: The protein encoded by this gene plays a central role in the regulation of circadian rhythms. The protein encodes a transcription factor of the basic helix-loop-helix (bHLH) family and contains DNA binding histone acetyltransferase activity. The encoded protein forms a heterodimer with Arntl (Bmal1) that binds E-box enhancer elements upstream of Period (Per1, Per2, Per3) and Cryptochrome (Cry1, Cry2) genes and activates transcription of these genes. Per and Cry proteins heterodimerize and repress their own transcription by interacting in a feedback loop with Clock/Arntl complexes. Polymorphisms in this gene may be associated with behavioral changes, obesity, and metabolic syndrome. Two transcripts encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal circadian phase. Mice homozygous for a spontaneous mutation exhibit abnormal circadian rhythm, reproduction, behavior, hair cycle, macronutrient absorption, and metabolism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ano1	A	T	7: 144,618,863	S528T	probably benign	Het
Araf	G	T	X: 20,860,100	R601L	probably damaging	Homo
Bcl2l10	T	C	9: 75,351,072	I172T	possibly damaging	Het
Bpifb3	A	T	2: 153,929,323	N385I	possibly damaging	Het
Bsnd	A	G	4: 106,486,635	V158A	probably damaging	Het
Cacna1s	A	G	1: 136,089,045	N481S	probably benign	Het
Cdk5rap1	A	G	2: 154,368,241	V138A	probably damaging	Het
Cep290	A	G	10: 100,530,207	E1099G	probably damaging	Het
Cers1	T	A	8: 70,331,077	L225Q	probably damaging	Het
Cfb	T	C	17: 34,862,093	Q7R	probably benign	Het
Clk4	A	G	11: 51,271,921	S98G	possibly damaging	Het
Csmd3	T	C	15: 47,621,437	I3178V	probably benign	Het
Dock10	A	G	1: 80,538,823	S1397P	probably damaging	Het
Fer1l4	A	G	2: 156,029,268	L1421P	probably damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Greb1	G	T	12: 16,735,151	T91K	probably damaging	Het
Grid2ip	G	A	5: 143,380,429	S379N	probably damaging	Het
Gucy1b2	A	T	14: 62,415,939	C336S	probably damaging	Het
Hdac1	A	G	4: 129,519,109	C261R	probably damaging	Het
Hrasls5	C	T	19: 7,637,466	T231I	probably damaging	Het
Htt	T	C	5: 34,852,087	S1471P	possibly damaging	Het
Ice1	A	G	13: 70,594,839	V2134A	probably damaging	Het
Ikzf1	C	T	11: 11,768,961	Q310*	probably null	Het
Il3ra	G	A	14: 14,350,180	V112I	probably benign	Het
Kif21b	A	G	1: 136,149,418	I393V	possibly damaging	Het
Krt74	T	C	15: 101,763,437		noncoding transcript	Het
Krtap29-1	T	C	11: 99,978,983	N24S	probably null	Het
Mut	T	C	17: 40,956,245	V570A	probably benign	Het
Myh7	T	C	14: 54,979,486	D1138G	probably damaging	Het
Nktr	T	C	9: 121,731,565	I125T	probably damaging	Het
Nlrp2	A	T	7: 5,317,555	L861Q	probably damaging	Het
Notch3	C	A	17: 32,147,290	R990L	probably benign	Het
Nrap	T	C	19: 56,361,721	D655G	probably benign	Het
Olfr1329	A	T	4: 118,917,230	V79E	probably benign	Het
Olfr1451	G	A	19: 12,999,870	V295I	probably damaging	Het
Osbpl11	T	A	16: 33,227,056	I463N	probably damaging	Het
Pcsk6	A	T	7: 66,033,844	R749W	probably damaging	Het
Plxnb1	T	C	9: 109,112,141		probably null	Het
Polr1a	T	A	6: 71,954,890		probably null	Het
Ppm1g	T	C	5: 31,206,406	I153V	probably damaging	Het
Ppp1r12a	T	C	10: 108,260,890	S191P	probably benign	Het
Prodh	T	C	16: 18,081,058	K178E	possibly damaging	Het
Rilpl2	A	G	5: 124,469,848	V103A	possibly damaging	Het
Sap18b	C	T	8: 95,825,541	H60Y	probably benign	Het
Sclt1	A	G	3: 41,629,516		probably null	Het
Serpinb1a	G	T	13: 32,842,866	H364Q	probably damaging	Het
Sez6l	G	A	5: 112,475,365	Q107*	probably null	Het
Sipa1l2	C	T	8: 125,469,872	V708I	probably damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Uaca	T	A	9: 60,850,291		probably null	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Usp9y	C	T	Y: 1,316,735	R1938H	probably damaging	Homo
Wnk4	C	T	11: 101,265,431	R42W	probably damaging	Het
Zfp326	T	A	5: 105,905,980	L242Q	probably damaging	Het

Other mutations in Clock

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00598:Clock	APN	5	76229464	missense	probably benign	0.17
IGL00725:Clock	APN	5	76254413	nonsense	probably null
IGL01304:Clock	APN	5	76266355	critical splice donor site	probably null
IGL01369:Clock	APN	5	76237086	missense	probably benign	0.30
IGL01542:Clock	APN	5	76231475	missense	possibly damaging	0.82
IGL02541:Clock	APN	5	76262672	splice site	probably null
IGL02602:Clock	APN	5	76254426	missense	probably null	1.00
IGL02602:Clock	APN	5	76254427	missense	probably damaging	1.00
IGL03186:Clock	APN	5	76243082	missense	probably damaging	0.98
IGL03309:Clock	APN	5	76231394	critical splice donor site	probably null
R6760_Clock_188	UTSW	5	76226976	missense	unknown
uhr	UTSW	5	76229554	nonsense	probably null
R0304:Clock	UTSW	5	76226985	missense	unknown
R0593:Clock	UTSW	5	76265836	missense	probably benign	0.25
R0654:Clock	UTSW	5	76227129	missense	possibly damaging	0.95
R0684:Clock	UTSW	5	76245518	missense	probably damaging	0.96
R0707:Clock	UTSW	5	76227129	missense	possibly damaging	0.95
R0751:Clock	UTSW	5	76229361	missense	possibly damaging	0.75
R0865:Clock	UTSW	5	76266424	splice site	probably benign
R0920:Clock	UTSW	5	76230320	missense	possibly damaging	0.80
R1396:Clock	UTSW	5	76266802	missense	probably benign	0.00
R1450:Clock	UTSW	5	76262731	nonsense	probably null
R1487:Clock	UTSW	5	76266354	splice site	probably null
R1574:Clock	UTSW	5	76242832	missense	probably damaging	1.00
R1574:Clock	UTSW	5	76242832	missense	probably damaging	1.00
R1858:Clock	UTSW	5	76240909	missense	possibly damaging	0.92
R1872:Clock	UTSW	5	76248462	missense	possibly damaging	0.67
R1905:Clock	UTSW	5	76266888	splice site	probably benign
R1937:Clock	UTSW	5	76229493	missense	probably damaging	0.99
R2411:Clock	UTSW	5	76231513	missense	probably benign	0.08
R2887:Clock	UTSW	5	76245273	missense	probably damaging	0.99
R3410:Clock	UTSW	5	76229554	nonsense	probably null
R4514:Clock	UTSW	5	76230199	missense	probably benign	0.00
R4598:Clock	UTSW	5	76235810	missense	probably benign	0.00
R4599:Clock	UTSW	5	76235810	missense	probably benign	0.00
R4795:Clock	UTSW	5	76265916	missense	probably damaging	1.00
R4796:Clock	UTSW	5	76265916	missense	probably damaging	1.00
R4973:Clock	UTSW	5	76254411	missense	possibly damaging	0.62
R5204:Clock	UTSW	5	76243170	splice site	probably null
R5271:Clock	UTSW	5	76241954	missense	probably damaging	1.00
R5547:Clock	UTSW	5	76230338	missense	probably benign	0.02
R5630:Clock	UTSW	5	76230338	missense	probably benign	0.02
R5631:Clock	UTSW	5	76230338	missense	probably benign	0.02
R5632:Clock	UTSW	5	76230338	missense	probably benign	0.02
R5787:Clock	UTSW	5	76237051	missense	probably damaging	1.00
R6578:Clock	UTSW	5	76216709	missense	unknown
R6622:Clock	UTSW	5	76241954	missense	probably damaging	1.00
R6760:Clock	UTSW	5	76226976	missense	unknown
R6793:Clock	UTSW	5	76237120	frame shift	probably null
R7406:Clock	UTSW	5	76266845	start codon destroyed	probably null	0.26
R7414:Clock	UTSW	5	76262764	missense	probably benign	0.00
R7560:Clock	UTSW	5	76242891	splice site	probably null
R7593:Clock	UTSW	5	76236298	missense	possibly damaging	0.80
R7640:Clock	UTSW	5	76248378	missense	possibly damaging	0.71
R7708:Clock	UTSW	5	76266409	missense	probably benign	0.00
R7713:Clock	UTSW	5	76245420	critical splice donor site	probably null
R7807:Clock	UTSW	5	76243135	missense	probably benign	0.01
R8171:Clock	UTSW	5	76266414	missense	possibly damaging	0.94
R8190:Clock	UTSW	5	76227204	missense	probably damaging	0.98
R8225:Clock	UTSW	5	76241912	missense	probably damaging	0.99
R8309:Clock	UTSW	5	76254422	missense	probably benign	0.07
R8557:Clock	UTSW	5	76229370	missense	probably damaging	1.00
R8792:Clock	UTSW	5	76262727	missense	probably damaging	1.00
R8869:Clock	UTSW	5	76227042	small deletion	probably benign
R8870:Clock	UTSW	5	76235785	missense	probably benign	0.17
R8980:Clock	UTSW	5	76254439	missense	probably benign	0.01
R8982:Clock	UTSW	5	76216712	missense	unknown
R9177:Clock	UTSW	5	76229409	missense	probably benign	0.00
R9208:Clock	UTSW	5	76237024	missense	probably benign	0.00
R9213:Clock	UTSW	5	76245529	missense	possibly damaging	0.94
R9307:Clock	UTSW	5	76216824	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AGACCTCTTTGAAACATGCTTG -3'
(R):5'- ACATGCAATGTGTCTGTTTCC -3'

Sequencing Primer
(F):5'- AACATGCTTGTTTTCAGCTGAGGC -3'
(R):5'- CCATCTTGCCACAAAAGTTTTGGG -3'

Posted On

2018-03-15