Incidental Mutation 'R6274:Zfp326'
ID 507518
Institutional Source Beutler Lab
Gene Symbol Zfp326
Ensembl Gene ENSMUSG00000029290
Gene Name zinc finger protein 326
Synonyms 5730470H14Rik, ZAN75
MMRRC Submission 044444-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.431) question?
Stock # R6274 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 106024431-106063684 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 106053846 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 242 (L242Q)
Ref Sequence ENSEMBL: ENSMUSP00000118976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031227] [ENSMUST00000138615] [ENSMUST00000150440]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000031227
AA Change: L331Q

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031227
Gene: ENSMUSG00000029290
AA Change: L331Q

DomainStartEndE-ValueType
internal_repeat_1 19 39 1.09e-7 PROSPERO
internal_repeat_1 31 58 1.09e-7 PROSPERO
low complexity region 63 69 N/A INTRINSIC
low complexity region 154 162 N/A INTRINSIC
low complexity region 194 205 N/A INTRINSIC
coiled coil region 277 304 N/A INTRINSIC
ZnF_C2H2 312 336 4.12e0 SMART
ZnF_C2H2 405 430 1.78e2 SMART
low complexity region 483 561 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136558
Predicted Effect probably benign
Transcript: ENSMUST00000138615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147683
Predicted Effect probably damaging
Transcript: ENSMUST00000150440
AA Change: L242Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118976
Gene: ENSMUSG00000029290
AA Change: L242Q

DomainStartEndE-ValueType
internal_repeat_1 19 39 2.38e-7 PROSPERO
internal_repeat_1 31 58 2.38e-7 PROSPERO
low complexity region 63 73 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
coiled coil region 188 215 N/A INTRINSIC
ZnF_C2H2 223 247 4.12e0 SMART
ZnF_C2H2 316 341 1.78e2 SMART
low complexity region 389 415 N/A INTRINSIC
Meta Mutation Damage Score 0.4927 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Ano1 A T 7: 144,172,600 (GRCm39) S528T probably benign Het
Araf G T X: 20,726,339 (GRCm39) R601L probably damaging Homo
Bcl2l10 T C 9: 75,258,354 (GRCm39) I172T possibly damaging Het
Bpifb3 A T 2: 153,771,243 (GRCm39) N385I possibly damaging Het
Bsnd A G 4: 106,343,832 (GRCm39) V158A probably damaging Het
Cacna1s A G 1: 136,016,783 (GRCm39) N481S probably benign Het
Cdk5rap1 A G 2: 154,210,161 (GRCm39) V138A probably damaging Het
Cep290 A G 10: 100,366,069 (GRCm39) E1099G probably damaging Het
Cers1 T A 8: 70,783,727 (GRCm39) L225Q probably damaging Het
Cfb T C 17: 35,081,069 (GRCm39) Q7R probably benign Het
Clk4 A G 11: 51,162,748 (GRCm39) S98G possibly damaging Het
Clock A G 5: 76,385,000 (GRCm39) S406P probably benign Het
Csmd3 T C 15: 47,484,833 (GRCm39) I3178V probably benign Het
Dock10 A G 1: 80,516,540 (GRCm39) S1397P probably damaging Het
Fer1l4 A G 2: 155,871,188 (GRCm39) L1421P probably damaging Het
Fetub C T 16: 22,751,081 (GRCm39) R143C probably damaging Het
Greb1 G T 12: 16,785,152 (GRCm39) T91K probably damaging Het
Grid2ip G A 5: 143,366,184 (GRCm39) S379N probably damaging Het
Gucy1b2 A T 14: 62,653,388 (GRCm39) C336S probably damaging Het
Hdac1 A G 4: 129,412,902 (GRCm39) C261R probably damaging Het
Htt T C 5: 35,009,431 (GRCm39) S1471P possibly damaging Het
Ice1 A G 13: 70,742,958 (GRCm39) V2134A probably damaging Het
Ikzf1 C T 11: 11,718,961 (GRCm39) Q310* probably null Het
Il3ra G A 14: 14,350,180 (GRCm38) V112I probably benign Het
Kif21b A G 1: 136,077,156 (GRCm39) I393V possibly damaging Het
Krt74 T C 15: 101,671,872 (GRCm39) noncoding transcript Het
Krtap29-1 T C 11: 99,869,809 (GRCm39) N24S probably null Het
Mmut T C 17: 41,267,136 (GRCm39) V570A probably benign Het
Myh7 T C 14: 55,216,943 (GRCm39) D1138G probably damaging Het
Nktr T C 9: 121,560,631 (GRCm39) I125T probably damaging Het
Nlrp2 A T 7: 5,320,554 (GRCm39) L861Q probably damaging Het
Notch3 C A 17: 32,366,264 (GRCm39) R990L probably benign Het
Nrap T C 19: 56,350,153 (GRCm39) D655G probably benign Het
Or10ak8 A T 4: 118,774,427 (GRCm39) V79E probably benign Het
Or5b99 G A 19: 12,977,234 (GRCm39) V295I probably damaging Het
Osbpl11 T A 16: 33,047,426 (GRCm39) I463N probably damaging Het
Pcsk6 A T 7: 65,683,592 (GRCm39) R749W probably damaging Het
Plaat5 C T 19: 7,614,831 (GRCm39) T231I probably damaging Het
Plxnb1 T C 9: 108,941,209 (GRCm39) probably null Het
Polr1a T A 6: 71,931,874 (GRCm39) probably null Het
Ppm1g T C 5: 31,363,750 (GRCm39) I153V probably damaging Het
Ppp1r12a T C 10: 108,096,751 (GRCm39) S191P probably benign Het
Prodh T C 16: 17,898,922 (GRCm39) K178E possibly damaging Het
Rilpl2 A G 5: 124,607,911 (GRCm39) V103A possibly damaging Het
Sap18b C T 8: 96,552,169 (GRCm39) H60Y probably benign Het
Sclt1 A G 3: 41,583,951 (GRCm39) probably null Het
Serpinb1a G T 13: 33,026,849 (GRCm39) H364Q probably damaging Het
Sez6l G A 5: 112,623,231 (GRCm39) Q107* probably null Het
Sipa1l2 C T 8: 126,196,611 (GRCm39) V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 (GRCm39) G252R probably benign Het
Uaca T A 9: 60,757,573 (GRCm39) probably null Het
Uqcrc1 C A 9: 108,771,224 (GRCm39) H95N probably damaging Het
Usp9y C T Y: 1,316,735 (GRCm39) R1938H probably damaging Homo
Wnk4 C T 11: 101,156,257 (GRCm39) R42W probably damaging Het
Other mutations in Zfp326
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Zfp326 APN 5 106,054,911 (GRCm39) missense possibly damaging 0.89
IGL00432:Zfp326 APN 5 106,044,399 (GRCm39) missense probably damaging 0.98
IGL01551:Zfp326 APN 5 106,036,451 (GRCm39) missense probably damaging 1.00
IGL03197:Zfp326 APN 5 106,039,059 (GRCm39) missense probably benign 0.00
PIT4508001:Zfp326 UTSW 5 106,062,556 (GRCm39) missense probably benign 0.02
R0326:Zfp326 UTSW 5 106,058,141 (GRCm39) missense probably damaging 1.00
R0411:Zfp326 UTSW 5 106,026,641 (GRCm39) missense possibly damaging 0.81
R0634:Zfp326 UTSW 5 106,034,069 (GRCm39) nonsense probably null
R0850:Zfp326 UTSW 5 106,026,663 (GRCm39) splice site probably null
R1833:Zfp326 UTSW 5 106,039,035 (GRCm39) nonsense probably null
R2108:Zfp326 UTSW 5 106,062,646 (GRCm39) utr 3 prime probably benign
R2857:Zfp326 UTSW 5 106,036,395 (GRCm39) missense probably benign 0.11
R3702:Zfp326 UTSW 5 106,036,709 (GRCm39) splice site probably null
R4690:Zfp326 UTSW 5 106,054,942 (GRCm39) missense probably damaging 1.00
R5614:Zfp326 UTSW 5 106,036,361 (GRCm39) missense probably damaging 1.00
R6212:Zfp326 UTSW 5 106,058,097 (GRCm39) missense probably damaging 1.00
R6262:Zfp326 UTSW 5 106,036,353 (GRCm39) missense probably damaging 1.00
R6439:Zfp326 UTSW 5 106,036,584 (GRCm39) missense probably null 0.69
R6963:Zfp326 UTSW 5 106,059,359 (GRCm39) nonsense probably null
R8073:Zfp326 UTSW 5 106,062,682 (GRCm39) missense unknown
R8496:Zfp326 UTSW 5 106,036,451 (GRCm39) missense probably damaging 1.00
R9781:Zfp326 UTSW 5 106,062,825 (GRCm39) missense unknown
Z1088:Zfp326 UTSW 5 106,036,496 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAAGTACTTCACTGACCGTAC -3'
(R):5'- TGACAGATGACGCTGAATCAATG -3'

Sequencing Primer
(F):5'- CACTGACCGTACTGTCTGAATAGG -3'
(R):5'- CGCTGAATCAATGAACAATGTAGC -3'
Posted On 2018-03-15