Incidental Mutation 'R6274:Zfp326'
ID507518
Institutional Source Beutler Lab
Gene Symbol Zfp326
Ensembl Gene ENSMUSG00000029290
Gene Namezinc finger protein 326
Synonyms5730470H14Rik, ZAN75
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock #R6274 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location105876565-105915818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105905980 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 242 (L242Q)
Ref Sequence ENSEMBL: ENSMUSP00000118976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031227] [ENSMUST00000138615] [ENSMUST00000150440]
Predicted Effect probably damaging
Transcript: ENSMUST00000031227
AA Change: L331Q

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031227
Gene: ENSMUSG00000029290
AA Change: L331Q

DomainStartEndE-ValueType
internal_repeat_1 19 39 1.09e-7 PROSPERO
internal_repeat_1 31 58 1.09e-7 PROSPERO
low complexity region 63 69 N/A INTRINSIC
low complexity region 154 162 N/A INTRINSIC
low complexity region 194 205 N/A INTRINSIC
coiled coil region 277 304 N/A INTRINSIC
ZnF_C2H2 312 336 4.12e0 SMART
ZnF_C2H2 405 430 1.78e2 SMART
low complexity region 483 561 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136558
Predicted Effect probably benign
Transcript: ENSMUST00000138615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147683
Predicted Effect probably damaging
Transcript: ENSMUST00000150440
AA Change: L242Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118976
Gene: ENSMUSG00000029290
AA Change: L242Q

DomainStartEndE-ValueType
internal_repeat_1 19 39 2.38e-7 PROSPERO
internal_repeat_1 31 58 2.38e-7 PROSPERO
low complexity region 63 73 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
coiled coil region 188 215 N/A INTRINSIC
ZnF_C2H2 223 247 4.12e0 SMART
ZnF_C2H2 316 341 1.78e2 SMART
low complexity region 389 415 N/A INTRINSIC
Meta Mutation Damage Score 0.4927 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ano1 A T 7: 144,618,863 S528T probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Bcl2l10 T C 9: 75,351,072 I172T possibly damaging Het
Bpifb3 A T 2: 153,929,323 N385I possibly damaging Het
Bsnd A G 4: 106,486,635 V158A probably damaging Het
Cacna1s A G 1: 136,089,045 N481S probably benign Het
Cdk5rap1 A G 2: 154,368,241 V138A probably damaging Het
Cep290 A G 10: 100,530,207 E1099G probably damaging Het
Cers1 T A 8: 70,331,077 L225Q probably damaging Het
Cfb T C 17: 34,862,093 Q7R probably benign Het
Clk4 A G 11: 51,271,921 S98G possibly damaging Het
Clock A G 5: 76,237,153 S406P probably benign Het
Csmd3 T C 15: 47,621,437 I3178V probably benign Het
Dock10 A G 1: 80,538,823 S1397P probably damaging Het
Fer1l4 A G 2: 156,029,268 L1421P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Greb1 G T 12: 16,735,151 T91K probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
Gucy1b2 A T 14: 62,415,939 C336S probably damaging Het
Hdac1 A G 4: 129,519,109 C261R probably damaging Het
Hrasls5 C T 19: 7,637,466 T231I probably damaging Het
Htt T C 5: 34,852,087 S1471P possibly damaging Het
Ice1 A G 13: 70,594,839 V2134A probably damaging Het
Ikzf1 C T 11: 11,768,961 Q310* probably null Het
Il3ra G A 14: 14,350,180 V112I probably benign Het
Kif21b A G 1: 136,149,418 I393V possibly damaging Het
Krt74 T C 15: 101,763,437 noncoding transcript Het
Krtap29-1 T C 11: 99,978,983 N24S probably null Het
Mut T C 17: 40,956,245 V570A probably benign Het
Myh7 T C 14: 54,979,486 D1138G probably damaging Het
Nktr T C 9: 121,731,565 I125T probably damaging Het
Nlrp2 A T 7: 5,317,555 L861Q probably damaging Het
Notch3 C A 17: 32,147,290 R990L probably benign Het
Nrap T C 19: 56,361,721 D655G probably benign Het
Olfr1329 A T 4: 118,917,230 V79E probably benign Het
Olfr1451 G A 19: 12,999,870 V295I probably damaging Het
Osbpl11 T A 16: 33,227,056 I463N probably damaging Het
Pcsk6 A T 7: 66,033,844 R749W probably damaging Het
Plxnb1 T C 9: 109,112,141 probably null Het
Polr1a T A 6: 71,954,890 probably null Het
Ppm1g T C 5: 31,206,406 I153V probably damaging Het
Ppp1r12a T C 10: 108,260,890 S191P probably benign Het
Prodh T C 16: 18,081,058 K178E possibly damaging Het
Rilpl2 A G 5: 124,469,848 V103A possibly damaging Het
Sap18b C T 8: 95,825,541 H60Y probably benign Het
Sclt1 A G 3: 41,629,516 probably null Het
Serpinb1a G T 13: 32,842,866 H364Q probably damaging Het
Sez6l G A 5: 112,475,365 Q107* probably null Het
Sipa1l2 C T 8: 125,469,872 V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Uaca T A 9: 60,850,291 probably null Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Usp9y C T Y: 1,316,735 R1938H probably damaging Homo
Wnk4 C T 11: 101,265,431 R42W probably damaging Het
Other mutations in Zfp326
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Zfp326 APN 5 105907045 missense possibly damaging 0.89
IGL00432:Zfp326 APN 5 105896533 missense probably damaging 0.98
IGL01551:Zfp326 APN 5 105888585 missense probably damaging 1.00
IGL03197:Zfp326 APN 5 105891193 missense probably benign 0.00
PIT4508001:Zfp326 UTSW 5 105914690 missense probably benign 0.02
R0326:Zfp326 UTSW 5 105910275 missense probably damaging 1.00
R0411:Zfp326 UTSW 5 105878775 missense possibly damaging 0.81
R0634:Zfp326 UTSW 5 105886203 nonsense probably null
R0850:Zfp326 UTSW 5 105878797 splice site probably null
R1833:Zfp326 UTSW 5 105891169 nonsense probably null
R2108:Zfp326 UTSW 5 105914780 utr 3 prime probably benign
R2857:Zfp326 UTSW 5 105888529 missense probably benign 0.11
R3702:Zfp326 UTSW 5 105888843 splice site probably null
R4690:Zfp326 UTSW 5 105907076 missense probably damaging 1.00
R5614:Zfp326 UTSW 5 105888495 missense probably damaging 1.00
R6212:Zfp326 UTSW 5 105910231 missense probably damaging 1.00
R6262:Zfp326 UTSW 5 105888487 missense probably damaging 1.00
R6439:Zfp326 UTSW 5 105888718 missense probably null 0.69
R6963:Zfp326 UTSW 5 105911493 nonsense probably null
R8073:Zfp326 UTSW 5 105914816 missense unknown
Z1088:Zfp326 UTSW 5 105888630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAAGTACTTCACTGACCGTAC -3'
(R):5'- TGACAGATGACGCTGAATCAATG -3'

Sequencing Primer
(F):5'- CACTGACCGTACTGTCTGAATAGG -3'
(R):5'- CGCTGAATCAATGAACAATGTAGC -3'
Posted On2018-03-15