Mutagenetix > Incidental Mutations

Incidental Mutation 'R6274:Sez6l'

507519

Institutional Source

Beutler Lab

Gene Symbol

Sez6l

Ensembl Gene

ENSMUSG00000058153

Gene Name

seizure related 6 homolog like

Synonyms

Acig1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6274 (G1)

Quality Score

192.009

Status

Validated

Chromosome

Chromosomal Location

112419151-112577185 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 112475365 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 107 (Q107*)

Ref Sequence

ENSEMBL: ENSMUSP00000148806 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075387] [ENSMUST00000079491] [ENSMUST00000197425] [ENSMUST00000212480] [ENSMUST00000212758]

Predicted Effect

probably null
Transcript: ENSMUST00000075387
AA Change: Q107*

SMART Domains

Protein: ENSMUSP00000074847
Gene: ENSMUSG00000058153
AA Change: Q107*

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
CUB	221	329	3.62e-8	SMART
CCP	333	388	1.01e-11	SMART
CUB	392	502	3.75e-15	SMART
CCP	507	564	1.41e-10	SMART
CUB	568	679	4.87e-23	SMART
CCP	685	740	4.95e-15	SMART
CCP	746	805	3.07e-11	SMART
CCP	813	870	8.04e-15	SMART
low complexity region	880	891	N/A	INTRINSIC
transmembrane domain	895	917	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000079491
AA Change: Q107*

SMART Domains

Protein: ENSMUSP00000078454
Gene: ENSMUSG00000058153
AA Change: Q107*

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
CUB	221	329	3.62e-8	SMART
CCP	333	388	1.01e-11	SMART
CUB	392	502	3.75e-15	SMART
CCP	507	564	1.41e-10	SMART
CUB	568	679	4.87e-23	SMART
CCP	685	740	4.95e-15	SMART
CCP	746	805	3.07e-11	SMART
CCP	813	870	8.04e-15	SMART
low complexity region	878	892	N/A	INTRINSIC
transmembrane domain	896	918	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000197425
AA Change: Q107*

SMART Domains

Protein: ENSMUSP00000143395
Gene: ENSMUSG00000058153
AA Change: Q107*

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
CUB	221	329	3.62e-8	SMART
CCP	333	388	1.01e-11	SMART
CUB	392	502	3.75e-15	SMART
CCP	507	564	1.41e-10	SMART
CUB	568	679	4.87e-23	SMART
CCP	685	740	4.95e-15	SMART
CCP	746	805	3.07e-11	SMART
low complexity region	815	826	N/A	INTRINSIC
transmembrane domain	830	852	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000200575

Predicted Effect

probably null
Transcript: ENSMUST00000212480
AA Change: Q107*

Predicted Effect

probably null
Transcript: ENSMUST00000212758
AA Change: Q107*

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.1%

Validation Efficiency

100% (56/56)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele display slightly impaired coordination in the rotarod task. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ano1	A	T	7: 144,618,863	S528T	probably benign	Het
Araf	G	T	X: 20,860,100	R601L	probably damaging	Homo
Bcl2l10	T	C	9: 75,351,072	I172T	possibly damaging	Het
Bpifb3	A	T	2: 153,929,323	N385I	possibly damaging	Het
Bsnd	A	G	4: 106,486,635	V158A	probably damaging	Het
Cacna1s	A	G	1: 136,089,045	N481S	probably benign	Het
Cdk5rap1	A	G	2: 154,368,241	V138A	probably damaging	Het
Cep290	A	G	10: 100,530,207	E1099G	probably damaging	Het
Cers1	T	A	8: 70,331,077	L225Q	probably damaging	Het
Cfb	T	C	17: 34,862,093	Q7R	probably benign	Het
Clk4	A	G	11: 51,271,921	S98G	possibly damaging	Het
Clock	A	G	5: 76,237,153	S406P	probably benign	Het
Csmd3	T	C	15: 47,621,437	I3178V	probably benign	Het
Dock10	A	G	1: 80,538,823	S1397P	probably damaging	Het
Fer1l4	A	G	2: 156,029,268	L1421P	probably damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Greb1	G	T	12: 16,735,151	T91K	probably damaging	Het
Grid2ip	G	A	5: 143,380,429	S379N	probably damaging	Het
Gucy1b2	A	T	14: 62,415,939	C336S	probably damaging	Het
Hdac1	A	G	4: 129,519,109	C261R	probably damaging	Het
Hrasls5	C	T	19: 7,637,466	T231I	probably damaging	Het
Htt	T	C	5: 34,852,087	S1471P	possibly damaging	Het
Ice1	A	G	13: 70,594,839	V2134A	probably damaging	Het
Ikzf1	C	T	11: 11,768,961	Q310*	probably null	Het
Il3ra	G	A	14: 14,350,180	V112I	probably benign	Het
Kif21b	A	G	1: 136,149,418	I393V	possibly damaging	Het
Krt74	T	C	15: 101,763,437		noncoding transcript	Het
Krtap29-1	T	C	11: 99,978,983	N24S	probably null	Het
Mut	T	C	17: 40,956,245	V570A	probably benign	Het
Myh7	T	C	14: 54,979,486	D1138G	probably damaging	Het
Nktr	T	C	9: 121,731,565	I125T	probably damaging	Het
Nlrp2	A	T	7: 5,317,555	L861Q	probably damaging	Het
Notch3	C	A	17: 32,147,290	R990L	probably benign	Het
Nrap	T	C	19: 56,361,721	D655G	probably benign	Het
Olfr1329	A	T	4: 118,917,230	V79E	probably benign	Het
Olfr1451	G	A	19: 12,999,870	V295I	probably damaging	Het
Osbpl11	T	A	16: 33,227,056	I463N	probably damaging	Het
Pcsk6	A	T	7: 66,033,844	R749W	probably damaging	Het
Plxnb1	T	C	9: 109,112,141		probably null	Het
Polr1a	T	A	6: 71,954,890		probably null	Het
Ppm1g	T	C	5: 31,206,406	I153V	probably damaging	Het
Ppp1r12a	T	C	10: 108,260,890	S191P	probably benign	Het
Prodh	T	C	16: 18,081,058	K178E	possibly damaging	Het
Rilpl2	A	G	5: 124,469,848	V103A	possibly damaging	Het
Sap18b	C	T	8: 95,825,541	H60Y	probably benign	Het
Sclt1	A	G	3: 41,629,516		probably null	Het
Serpinb1a	G	T	13: 32,842,866	H364Q	probably damaging	Het
Sipa1l2	C	T	8: 125,469,872	V708I	probably damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Uaca	T	A	9: 60,850,291		probably null	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Usp9y	C	T	Y: 1,316,735	R1938H	probably damaging	Homo
Wnk4	C	T	11: 101,265,431	R42W	probably damaging	Het
Zfp326	T	A	5: 105,905,980	L242Q	probably damaging	Het

Other mutations in Sez6l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Sez6l	APN	5	112424645	missense	probably damaging	1.00
IGL00494:Sez6l	APN	5	112463003	missense	probably damaging	1.00
IGL00693:Sez6l	APN	5	112422013	missense	probably damaging	1.00
IGL01146:Sez6l	APN	5	112428409	missense	probably damaging	1.00
IGL01382:Sez6l	APN	5	112425621	missense	probably benign	0.00
IGL01393:Sez6l	APN	5	112438395	splice site	probably benign
IGL01961:Sez6l	APN	5	112471731	missense	probably damaging	1.00
IGL02101:Sez6l	APN	5	112472746	missense	probably damaging	1.00
IGL02104:Sez6l	APN	5	112426764	intron	probably benign
IGL02316:Sez6l	APN	5	112462962	missense	probably damaging	1.00
IGL02965:Sez6l	APN	5	112475574	missense	probably damaging	0.99
IGL03102:Sez6l	APN	5	112475403	missense	probably benign	0.02
IGL03112:Sez6l	APN	5	112473467	missense	probably damaging	1.00
IGL03180:Sez6l	APN	5	112436285	missense	probably damaging	1.00
ranger	UTSW	5	112576812	synonymous	probably null
R0245:Sez6l	UTSW	5	112475566	missense	probably benign
R0662:Sez6l	UTSW	5	112473422	missense	probably damaging	1.00
R1227:Sez6l	UTSW	5	112473464	missense	probably damaging	1.00
R1605:Sez6l	UTSW	5	112475049	missense	probably damaging	1.00
R1873:Sez6l	UTSW	5	112473410	splice site	probably benign
R1878:Sez6l	UTSW	5	112475223	missense	probably damaging	0.98
R1892:Sez6l	UTSW	5	112472799	missense	probably damaging	1.00
R1961:Sez6l	UTSW	5	112424615	splice site	probably benign
R2038:Sez6l	UTSW	5	112472752	missense	possibly damaging	0.81
R2212:Sez6l	UTSW	5	112475361	missense	possibly damaging	0.76
R2315:Sez6l	UTSW	5	112464597	missense	probably benign	0.02
R2343:Sez6l	UTSW	5	112464731	missense	probably damaging	1.00
R3412:Sez6l	UTSW	5	112475361	missense	possibly damaging	0.76
R3413:Sez6l	UTSW	5	112475361	missense	possibly damaging	0.76
R3423:Sez6l	UTSW	5	112426749	missense	probably damaging	0.99
R3425:Sez6l	UTSW	5	112426749	missense	probably damaging	0.99
R4081:Sez6l	UTSW	5	112461166	missense	probably benign	0.01
R4574:Sez6l	UTSW	5	112428478	missense	probably damaging	1.00
R5792:Sez6l	UTSW	5	112422024	nonsense	probably null
R5864:Sez6l	UTSW	5	112438400	critical splice donor site	probably null
R6236:Sez6l	UTSW	5	112475244	missense	possibly damaging	0.86
R6466:Sez6l	UTSW	5	112461141	splice site	probably null
R6574:Sez6l	UTSW	5	112576826	missense	possibly damaging	0.89
R7008:Sez6l	UTSW	5	112464695	missense	probably damaging	1.00
R7241:Sez6l	UTSW	5	112473480	missense	probably benign
R7329:Sez6l	UTSW	5	112440907	missense	probably damaging	0.99
R7335:Sez6l	UTSW	5	112576812	synonymous	probably null
R7502:Sez6l	UTSW	5	112475481	missense	possibly damaging	0.89
R7870:Sez6l	UTSW	5	112438581	missense	probably damaging	1.00
R8260:Sez6l	UTSW	5	112461256	missense	probably benign	0.23
X0052:Sez6l	UTSW	5	112472901	missense	possibly damaging	0.75
Z1088:Sez6l	UTSW	5	112440915	missense	probably damaging	1.00
Z1177:Sez6l	UTSW	5	112576932	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- ATGAGCCTCGTATACCTGGG -3'
(R):5'- AGAGATGCACCCTTCCACTG -3'

Sequencing Primer
(F):5'- AGACCCGGTCAGCTCATTGTC -3'
(R):5'- ATGCACCCTTCCACTGCCTAC -3'

Posted On

2018-03-15