Incidental Mutation 'R6274:Sez6l'
ID507519
Institutional Source Beutler Lab
Gene Symbol Sez6l
Ensembl Gene ENSMUSG00000058153
Gene Nameseizure related 6 homolog like
SynonymsAcig1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6274 (G1)
Quality Score192.009
Status Validated
Chromosome5
Chromosomal Location112419151-112577185 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 112475365 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 107 (Q107*)
Ref Sequence ENSEMBL: ENSMUSP00000148806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075387] [ENSMUST00000079491] [ENSMUST00000197425] [ENSMUST00000212480] [ENSMUST00000212758]
Predicted Effect probably null
Transcript: ENSMUST00000075387
AA Change: Q107*
SMART Domains Protein: ENSMUSP00000074847
Gene: ENSMUSG00000058153
AA Change: Q107*

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
CUB 221 329 3.62e-8 SMART
CCP 333 388 1.01e-11 SMART
CUB 392 502 3.75e-15 SMART
CCP 507 564 1.41e-10 SMART
CUB 568 679 4.87e-23 SMART
CCP 685 740 4.95e-15 SMART
CCP 746 805 3.07e-11 SMART
CCP 813 870 8.04e-15 SMART
low complexity region 880 891 N/A INTRINSIC
transmembrane domain 895 917 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000079491
AA Change: Q107*
SMART Domains Protein: ENSMUSP00000078454
Gene: ENSMUSG00000058153
AA Change: Q107*

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
CUB 221 329 3.62e-8 SMART
CCP 333 388 1.01e-11 SMART
CUB 392 502 3.75e-15 SMART
CCP 507 564 1.41e-10 SMART
CUB 568 679 4.87e-23 SMART
CCP 685 740 4.95e-15 SMART
CCP 746 805 3.07e-11 SMART
CCP 813 870 8.04e-15 SMART
low complexity region 878 892 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000197425
AA Change: Q107*
SMART Domains Protein: ENSMUSP00000143395
Gene: ENSMUSG00000058153
AA Change: Q107*

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
CUB 221 329 3.62e-8 SMART
CCP 333 388 1.01e-11 SMART
CUB 392 502 3.75e-15 SMART
CCP 507 564 1.41e-10 SMART
CUB 568 679 4.87e-23 SMART
CCP 685 740 4.95e-15 SMART
CCP 746 805 3.07e-11 SMART
low complexity region 815 826 N/A INTRINSIC
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200575
Predicted Effect probably null
Transcript: ENSMUST00000212480
AA Change: Q107*
Predicted Effect probably null
Transcript: ENSMUST00000212758
AA Change: Q107*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display slightly impaired coordination in the rotarod task. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ano1 A T 7: 144,618,863 S528T probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Bcl2l10 T C 9: 75,351,072 I172T possibly damaging Het
Bpifb3 A T 2: 153,929,323 N385I possibly damaging Het
Bsnd A G 4: 106,486,635 V158A probably damaging Het
Cacna1s A G 1: 136,089,045 N481S probably benign Het
Cdk5rap1 A G 2: 154,368,241 V138A probably damaging Het
Cep290 A G 10: 100,530,207 E1099G probably damaging Het
Cers1 T A 8: 70,331,077 L225Q probably damaging Het
Cfb T C 17: 34,862,093 Q7R probably benign Het
Clk4 A G 11: 51,271,921 S98G possibly damaging Het
Clock A G 5: 76,237,153 S406P probably benign Het
Csmd3 T C 15: 47,621,437 I3178V probably benign Het
Dock10 A G 1: 80,538,823 S1397P probably damaging Het
Fer1l4 A G 2: 156,029,268 L1421P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Greb1 G T 12: 16,735,151 T91K probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
Gucy1b2 A T 14: 62,415,939 C336S probably damaging Het
Hdac1 A G 4: 129,519,109 C261R probably damaging Het
Hrasls5 C T 19: 7,637,466 T231I probably damaging Het
Htt T C 5: 34,852,087 S1471P possibly damaging Het
Ice1 A G 13: 70,594,839 V2134A probably damaging Het
Ikzf1 C T 11: 11,768,961 Q310* probably null Het
Il3ra G A 14: 14,350,180 V112I probably benign Het
Kif21b A G 1: 136,149,418 I393V possibly damaging Het
Krt74 T C 15: 101,763,437 noncoding transcript Het
Krtap29-1 T C 11: 99,978,983 N24S probably null Het
Mut T C 17: 40,956,245 V570A probably benign Het
Myh7 T C 14: 54,979,486 D1138G probably damaging Het
Nktr T C 9: 121,731,565 I125T probably damaging Het
Nlrp2 A T 7: 5,317,555 L861Q probably damaging Het
Notch3 C A 17: 32,147,290 R990L probably benign Het
Nrap T C 19: 56,361,721 D655G probably benign Het
Olfr1329 A T 4: 118,917,230 V79E probably benign Het
Olfr1451 G A 19: 12,999,870 V295I probably damaging Het
Osbpl11 T A 16: 33,227,056 I463N probably damaging Het
Pcsk6 A T 7: 66,033,844 R749W probably damaging Het
Plxnb1 T C 9: 109,112,141 probably null Het
Polr1a T A 6: 71,954,890 probably null Het
Ppm1g T C 5: 31,206,406 I153V probably damaging Het
Ppp1r12a T C 10: 108,260,890 S191P probably benign Het
Prodh T C 16: 18,081,058 K178E possibly damaging Het
Rilpl2 A G 5: 124,469,848 V103A possibly damaging Het
Sap18b C T 8: 95,825,541 H60Y probably benign Het
Sclt1 A G 3: 41,629,516 probably null Het
Serpinb1a G T 13: 32,842,866 H364Q probably damaging Het
Sipa1l2 C T 8: 125,469,872 V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Uaca T A 9: 60,850,291 probably null Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Usp9y C T Y: 1,316,735 R1938H probably damaging Homo
Wnk4 C T 11: 101,265,431 R42W probably damaging Het
Zfp326 T A 5: 105,905,980 L242Q probably damaging Het
Other mutations in Sez6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Sez6l APN 5 112424645 missense probably damaging 1.00
IGL00494:Sez6l APN 5 112463003 missense probably damaging 1.00
IGL00693:Sez6l APN 5 112422013 missense probably damaging 1.00
IGL01146:Sez6l APN 5 112428409 missense probably damaging 1.00
IGL01382:Sez6l APN 5 112425621 missense probably benign 0.00
IGL01393:Sez6l APN 5 112438395 splice site probably benign
IGL01961:Sez6l APN 5 112471731 missense probably damaging 1.00
IGL02101:Sez6l APN 5 112472746 missense probably damaging 1.00
IGL02104:Sez6l APN 5 112426764 intron probably benign
IGL02316:Sez6l APN 5 112462962 missense probably damaging 1.00
IGL02965:Sez6l APN 5 112475574 missense probably damaging 0.99
IGL03102:Sez6l APN 5 112475403 missense probably benign 0.02
IGL03112:Sez6l APN 5 112473467 missense probably damaging 1.00
IGL03180:Sez6l APN 5 112436285 missense probably damaging 1.00
ranger UTSW 5 112576812 synonymous probably null
R0245:Sez6l UTSW 5 112475566 missense probably benign
R0662:Sez6l UTSW 5 112473422 missense probably damaging 1.00
R1227:Sez6l UTSW 5 112473464 missense probably damaging 1.00
R1605:Sez6l UTSW 5 112475049 missense probably damaging 1.00
R1873:Sez6l UTSW 5 112473410 splice site probably benign
R1878:Sez6l UTSW 5 112475223 missense probably damaging 0.98
R1892:Sez6l UTSW 5 112472799 missense probably damaging 1.00
R1961:Sez6l UTSW 5 112424615 splice site probably benign
R2038:Sez6l UTSW 5 112472752 missense possibly damaging 0.81
R2212:Sez6l UTSW 5 112475361 missense possibly damaging 0.76
R2315:Sez6l UTSW 5 112464597 missense probably benign 0.02
R2343:Sez6l UTSW 5 112464731 missense probably damaging 1.00
R3412:Sez6l UTSW 5 112475361 missense possibly damaging 0.76
R3413:Sez6l UTSW 5 112475361 missense possibly damaging 0.76
R3423:Sez6l UTSW 5 112426749 missense probably damaging 0.99
R3425:Sez6l UTSW 5 112426749 missense probably damaging 0.99
R4081:Sez6l UTSW 5 112461166 missense probably benign 0.01
R4574:Sez6l UTSW 5 112428478 missense probably damaging 1.00
R5792:Sez6l UTSW 5 112422024 nonsense probably null
R5864:Sez6l UTSW 5 112438400 critical splice donor site probably null
R6236:Sez6l UTSW 5 112475244 missense possibly damaging 0.86
R6466:Sez6l UTSW 5 112461141 splice site probably null
R6574:Sez6l UTSW 5 112576826 missense possibly damaging 0.89
R7008:Sez6l UTSW 5 112464695 missense probably damaging 1.00
R7241:Sez6l UTSW 5 112473480 missense probably benign
R7329:Sez6l UTSW 5 112440907 missense probably damaging 0.99
R7335:Sez6l UTSW 5 112576812 synonymous probably null
R7502:Sez6l UTSW 5 112475481 missense possibly damaging 0.89
R7870:Sez6l UTSW 5 112438581 missense probably damaging 1.00
R8260:Sez6l UTSW 5 112461256 missense probably benign 0.23
X0052:Sez6l UTSW 5 112472901 missense possibly damaging 0.75
Z1088:Sez6l UTSW 5 112440915 missense probably damaging 1.00
Z1177:Sez6l UTSW 5 112576932 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATGAGCCTCGTATACCTGGG -3'
(R):5'- AGAGATGCACCCTTCCACTG -3'

Sequencing Primer
(F):5'- AGACCCGGTCAGCTCATTGTC -3'
(R):5'- ATGCACCCTTCCACTGCCTAC -3'
Posted On2018-03-15