Incidental Mutation 'R6274:Rilpl2'
ID507520
Institutional Source Beutler Lab
Gene Symbol Rilpl2
Ensembl Gene ENSMUSG00000029401
Gene NameRab interacting lysosomal protein-like 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6274 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location124463265-124478366 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124469848 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 103 (V103A)
Ref Sequence ENSEMBL: ENSMUSP00000031347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031347]
PDB Structure
Crystal Structure of MyoVa-GTD in Complex with Two Cargos [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031347
AA Change: V103A

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031347
Gene: ENSMUSG00000029401
AA Change: V103A

DomainStartEndE-ValueType
PDB:4KP3|D 1 97 3e-54 PDB
Pfam:RILP 123 180 3.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119162
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a rab-interacting lysosomal protein-like domain. This protein may be involved in regulating lysosome morphology. This protein may also be a target for the Hepatitis C virus and assist in viral replication. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ano1 A T 7: 144,618,863 S528T probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Bcl2l10 T C 9: 75,351,072 I172T possibly damaging Het
Bpifb3 A T 2: 153,929,323 N385I possibly damaging Het
Bsnd A G 4: 106,486,635 V158A probably damaging Het
Cacna1s A G 1: 136,089,045 N481S probably benign Het
Cdk5rap1 A G 2: 154,368,241 V138A probably damaging Het
Cep290 A G 10: 100,530,207 E1099G probably damaging Het
Cers1 T A 8: 70,331,077 L225Q probably damaging Het
Cfb T C 17: 34,862,093 Q7R probably benign Het
Clk4 A G 11: 51,271,921 S98G possibly damaging Het
Clock A G 5: 76,237,153 S406P probably benign Het
Csmd3 T C 15: 47,621,437 I3178V probably benign Het
Dock10 A G 1: 80,538,823 S1397P probably damaging Het
Fer1l4 A G 2: 156,029,268 L1421P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Greb1 G T 12: 16,735,151 T91K probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
Gucy1b2 A T 14: 62,415,939 C336S probably damaging Het
Hdac1 A G 4: 129,519,109 C261R probably damaging Het
Hrasls5 C T 19: 7,637,466 T231I probably damaging Het
Htt T C 5: 34,852,087 S1471P possibly damaging Het
Ice1 A G 13: 70,594,839 V2134A probably damaging Het
Ikzf1 C T 11: 11,768,961 Q310* probably null Het
Il3ra G A 14: 14,350,180 V112I probably benign Het
Kif21b A G 1: 136,149,418 I393V possibly damaging Het
Krt74 T C 15: 101,763,437 noncoding transcript Het
Krtap29-1 T C 11: 99,978,983 N24S probably null Het
Mut T C 17: 40,956,245 V570A probably benign Het
Myh7 T C 14: 54,979,486 D1138G probably damaging Het
Nktr T C 9: 121,731,565 I125T probably damaging Het
Nlrp2 A T 7: 5,317,555 L861Q probably damaging Het
Notch3 C A 17: 32,147,290 R990L probably benign Het
Nrap T C 19: 56,361,721 D655G probably benign Het
Olfr1329 A T 4: 118,917,230 V79E probably benign Het
Olfr1451 G A 19: 12,999,870 V295I probably damaging Het
Osbpl11 T A 16: 33,227,056 I463N probably damaging Het
Pcsk6 A T 7: 66,033,844 R749W probably damaging Het
Plxnb1 T C 9: 109,112,141 probably null Het
Polr1a T A 6: 71,954,890 probably null Het
Ppm1g T C 5: 31,206,406 I153V probably damaging Het
Ppp1r12a T C 10: 108,260,890 S191P probably benign Het
Prodh T C 16: 18,081,058 K178E possibly damaging Het
Sap18b C T 8: 95,825,541 H60Y probably benign Het
Sclt1 A G 3: 41,629,516 probably null Het
Serpinb1a G T 13: 32,842,866 H364Q probably damaging Het
Sez6l G A 5: 112,475,365 Q107* probably null Het
Sipa1l2 C T 8: 125,469,872 V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Uaca T A 9: 60,850,291 probably null Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Usp9y C T Y: 1,316,735 R1938H probably damaging Homo
Wnk4 C T 11: 101,265,431 R42W probably damaging Het
Zfp326 T A 5: 105,905,980 L242Q probably damaging Het
Other mutations in Rilpl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02015:Rilpl2 APN 5 124469813 missense probably benign 0.04
R2866:Rilpl2 UTSW 5 124477835 missense probably damaging 0.99
R4828:Rilpl2 UTSW 5 124469812 missense possibly damaging 0.88
R5080:Rilpl2 UTSW 5 124469813 missense probably benign 0.04
R5874:Rilpl2 UTSW 5 124469813 missense probably benign 0.04
R6316:Rilpl2 UTSW 5 124477880 missense probably damaging 1.00
R6697:Rilpl2 UTSW 5 124469780 missense probably damaging 1.00
R6698:Rilpl2 UTSW 5 124469780 missense probably damaging 1.00
R6700:Rilpl2 UTSW 5 124469780 missense probably damaging 1.00
R7030:Rilpl2 UTSW 5 124468593 missense probably damaging 1.00
R7439:Rilpl2 UTSW 5 124463788 missense probably benign
R7682:Rilpl2 UTSW 5 124477980 missense probably damaging 1.00
R8373:Rilpl2 UTSW 5 124478034 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCCAAAGCCACCATGGGGA -3'
(R):5'- AGTGCTCAGCATCTTCCTCC -3'

Sequencing Primer
(F):5'- AGCCCACCTCCTGTAGC -3'
(R):5'- GTTAGATCCCCTGGAACTAGAGTC -3'
Posted On2018-03-15