Mutagenetix > Incidental Mutation

Incidental Mutation 'R6274:Grid2ip'

507521

Institutional Source

Beutler Lab

Gene Symbol

Grid2ip

Ensembl Gene

ENSMUSG00000010825

Gene Name

glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1

Synonyms

delphilin

MMRRC Submission

044444-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

R6274 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

143357338-143392152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 143380429 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 379 (S379N)

Ref Sequence

ENSEMBL: ENSMUSP00000010969 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010969] [ENSMUST00000110733] [ENSMUST00000120825]

AlphaFold

Q0QWG9

Predicted Effect

probably damaging
Transcript: ENSMUST00000010969
AA Change: S379N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000010969
Gene: ENSMUSG00000010825
AA Change: S379N

Domain	Start	End	E-Value	Type
low complexity region	30	55	N/A	INTRINSIC
low complexity region	57	73	N/A	INTRINSIC
low complexity region	78	92	N/A	INTRINSIC
PDZ	97	166	9.5e-16	SMART
low complexity region	256	272	N/A	INTRINSIC
low complexity region	284	304	N/A	INTRINSIC
low complexity region	429	446	N/A	INTRINSIC
low complexity region	464	478	N/A	INTRINSIC
low complexity region	536	584	N/A	INTRINSIC
low complexity region	607	625	N/A	INTRINSIC
FH2	633	1022	1.39e-35	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110733
AA Change: S558N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000106361
Gene: ENSMUSG00000010825
AA Change: S558N

Domain	Start	End	E-Value	Type
PDZ	10	80	1.13e-13	SMART
low complexity region	98	109	N/A	INTRINSIC
low complexity region	209	234	N/A	INTRINSIC
low complexity region	236	252	N/A	INTRINSIC
low complexity region	257	271	N/A	INTRINSIC
PDZ	276	345	9.5e-16	SMART
low complexity region	435	451	N/A	INTRINSIC
low complexity region	463	483	N/A	INTRINSIC
low complexity region	608	625	N/A	INTRINSIC
low complexity region	643	657	N/A	INTRINSIC
low complexity region	715	763	N/A	INTRINSIC
low complexity region	786	804	N/A	INTRINSIC
FH2	812	1201	1.39e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000120825
AA Change: S386N

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000113443
Gene: ENSMUSG00000010825
AA Change: S386N

Domain	Start	End	E-Value	Type
low complexity region	37	62	N/A	INTRINSIC
low complexity region	64	80	N/A	INTRINSIC
low complexity region	85	99	N/A	INTRINSIC
PDZ	104	173	9.5e-16	SMART
low complexity region	263	279	N/A	INTRINSIC
low complexity region	291	311	N/A	INTRINSIC
low complexity region	436	453	N/A	INTRINSIC
low complexity region	471	485	N/A	INTRINSIC
low complexity region	543	591	N/A	INTRINSIC
low complexity region	614	632	N/A	INTRINSIC
FH2	640	1029	1.39e-35	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138948

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196148

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.1%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamate receptor delta-2 (GRID2; MIM 602368) is predominantly expressed at parallel fiber-Purkinje cell postsynapses and plays crucial roles in synaptogenesis and synaptic plasticity. GRID2IP1 interacts with GRID2 and may control GRID2 signaling in Purkinje cells (Matsuda et al., 2006 [PubMed 16835239]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display facilitated long-term depression induction at parallel fiber-Purkinje cell synapses as well as enhanced optokinetic response adaptation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ano1	A	T	7: 144,618,863	S528T	probably benign	Het
Araf	G	T	X: 20,860,100	R601L	probably damaging	Homo
Bcl2l10	T	C	9: 75,351,072	I172T	possibly damaging	Het
Bpifb3	A	T	2: 153,929,323	N385I	possibly damaging	Het
Bsnd	A	G	4: 106,486,635	V158A	probably damaging	Het
Cacna1s	A	G	1: 136,089,045	N481S	probably benign	Het
Cdk5rap1	A	G	2: 154,368,241	V138A	probably damaging	Het
Cep290	A	G	10: 100,530,207	E1099G	probably damaging	Het
Cers1	T	A	8: 70,331,077	L225Q	probably damaging	Het
Cfb	T	C	17: 34,862,093	Q7R	probably benign	Het
Clk4	A	G	11: 51,271,921	S98G	possibly damaging	Het
Clock	A	G	5: 76,237,153	S406P	probably benign	Het
Csmd3	T	C	15: 47,621,437	I3178V	probably benign	Het
Dock10	A	G	1: 80,538,823	S1397P	probably damaging	Het
Fer1l4	A	G	2: 156,029,268	L1421P	probably damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Greb1	G	T	12: 16,735,151	T91K	probably damaging	Het
Gucy1b2	A	T	14: 62,415,939	C336S	probably damaging	Het
Hdac1	A	G	4: 129,519,109	C261R	probably damaging	Het
Hrasls5	C	T	19: 7,637,466	T231I	probably damaging	Het
Htt	T	C	5: 34,852,087	S1471P	possibly damaging	Het
Ice1	A	G	13: 70,594,839	V2134A	probably damaging	Het
Ikzf1	C	T	11: 11,768,961	Q310*	probably null	Het
Il3ra	G	A	14: 14,350,180	V112I	probably benign	Het
Kif21b	A	G	1: 136,149,418	I393V	possibly damaging	Het
Krt74	T	C	15: 101,763,437		noncoding transcript	Het
Krtap29-1	T	C	11: 99,978,983	N24S	probably null	Het
Mut	T	C	17: 40,956,245	V570A	probably benign	Het
Myh7	T	C	14: 54,979,486	D1138G	probably damaging	Het
Nktr	T	C	9: 121,731,565	I125T	probably damaging	Het
Nlrp2	A	T	7: 5,317,555	L861Q	probably damaging	Het
Notch3	C	A	17: 32,147,290	R990L	probably benign	Het
Nrap	T	C	19: 56,361,721	D655G	probably benign	Het
Olfr1329	A	T	4: 118,917,230	V79E	probably benign	Het
Olfr1451	G	A	19: 12,999,870	V295I	probably damaging	Het
Osbpl11	T	A	16: 33,227,056	I463N	probably damaging	Het
Pcsk6	A	T	7: 66,033,844	R749W	probably damaging	Het
Plxnb1	T	C	9: 109,112,141		probably null	Het
Polr1a	T	A	6: 71,954,890		probably null	Het
Ppm1g	T	C	5: 31,206,406	I153V	probably damaging	Het
Ppp1r12a	T	C	10: 108,260,890	S191P	probably benign	Het
Prodh	T	C	16: 18,081,058	K178E	possibly damaging	Het
Rilpl2	A	G	5: 124,469,848	V103A	possibly damaging	Het
Sap18b	C	T	8: 95,825,541	H60Y	probably benign	Het
Sclt1	A	G	3: 41,629,516		probably null	Het
Serpinb1a	G	T	13: 32,842,866	H364Q	probably damaging	Het
Sez6l	G	A	5: 112,475,365	Q107*	probably null	Het
Sipa1l2	C	T	8: 125,469,872	V708I	probably damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Uaca	T	A	9: 60,850,291		probably null	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Usp9y	C	T	Y: 1,316,735	R1938H	probably damaging	Homo
Wnk4	C	T	11: 101,265,431	R42W	probably damaging	Het
Zfp326	T	A	5: 105,905,980	L242Q	probably damaging	Het

Other mutations in Grid2ip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02271:Grid2ip	APN	5	143388909	missense	probably benign
IGL02894:Grid2ip	APN	5	143391108	missense	probably benign	0.04
R0024:Grid2ip	UTSW	5	143391041	missense	probably damaging	1.00
R0355:Grid2ip	UTSW	5	143357897	missense	probably benign	0.10
R0403:Grid2ip	UTSW	5	143357620	missense	possibly damaging	0.84
R0523:Grid2ip	UTSW	5	143373043	missense	possibly damaging	0.85
R0605:Grid2ip	UTSW	5	143379362	missense	probably damaging	0.99
R0664:Grid2ip	UTSW	5	143363977	critical splice donor site	probably null
R1116:Grid2ip	UTSW	5	143382914	missense	possibly damaging	0.96
R1251:Grid2ip	UTSW	5	143386015	missense	possibly damaging	0.69
R1381:Grid2ip	UTSW	5	143362651	missense	probably benign	0.00
R1384:Grid2ip	UTSW	5	143386096	critical splice donor site	probably null
R1477:Grid2ip	UTSW	5	143375585	missense	probably damaging	1.00
R2266:Grid2ip	UTSW	5	143386092	missense	probably benign	0.01
R2267:Grid2ip	UTSW	5	143386092	missense	probably benign	0.01
R2304:Grid2ip	UTSW	5	143387840	missense	probably damaging	1.00
R2871:Grid2ip	UTSW	5	143357929	missense	probably benign
R2871:Grid2ip	UTSW	5	143357929	missense	probably benign
R2873:Grid2ip	UTSW	5	143357929	missense	probably benign
R2874:Grid2ip	UTSW	5	143357929	missense	probably benign
R3196:Grid2ip	UTSW	5	143388178	missense	probably damaging	0.99
R3622:Grid2ip	UTSW	5	143386019	missense	probably damaging	1.00
R3930:Grid2ip	UTSW	5	143386039	missense	probably damaging	1.00
R4628:Grid2ip	UTSW	5	143382875	missense	probably damaging	1.00
R4696:Grid2ip	UTSW	5	143391376	intron	probably benign
R4709:Grid2ip	UTSW	5	143388903	missense	probably damaging	1.00
R4772:Grid2ip	UTSW	5	143375700	missense	possibly damaging	0.91
R4838:Grid2ip	UTSW	5	143388775	nonsense	probably null
R4857:Grid2ip	UTSW	5	143382629	missense	probably damaging	1.00
R5243:Grid2ip	UTSW	5	143377505	missense	probably damaging	1.00
R5894:Grid2ip	UTSW	5	143388911	missense	probably damaging	1.00
R6014:Grid2ip	UTSW	5	143387823	missense	possibly damaging	0.84
R6076:Grid2ip	UTSW	5	143387375	missense	probably benign	0.17
R6209:Grid2ip	UTSW	5	143380429	missense	probably damaging	1.00
R6257:Grid2ip	UTSW	5	143380429	missense	probably damaging	1.00
R6439:Grid2ip	UTSW	5	143373502	missense	probably damaging	0.99
R7098:Grid2ip	UTSW	5	143357591	missense	probably damaging	0.97
R7405:Grid2ip	UTSW	5	143380444	missense	probably benign	0.03
R7652:Grid2ip	UTSW	5	143382638	missense	probably damaging	1.00
R8259:Grid2ip	UTSW	5	143362589	missense	probably benign	0.20
R8261:Grid2ip	UTSW	5	143381940	critical splice donor site	probably null
R8350:Grid2ip	UTSW	5	143377518	missense	probably damaging	1.00
R8391:Grid2ip	UTSW	5	143380196	missense	probably damaging	0.98
R8450:Grid2ip	UTSW	5	143377518	missense	probably damaging	1.00
R8793:Grid2ip	UTSW	5	143377641	missense	probably damaging	1.00
R8851:Grid2ip	UTSW	5	143362597	missense	possibly damaging	0.94
R8944:Grid2ip	UTSW	5	143380505	critical splice donor site	probably null
R9022:Grid2ip	UTSW	5	143380449	missense	probably benign	0.02
R9227:Grid2ip	UTSW	5	143373439	missense	probably damaging	0.99
R9230:Grid2ip	UTSW	5	143373439	missense	probably damaging	0.99
R9382:Grid2ip	UTSW	5	143375348	critical splice donor site	probably null
R9425:Grid2ip	UTSW	5	143381680	missense
X0010:Grid2ip	UTSW	5	143357878	missense	probably benign	0.01
X0012:Grid2ip	UTSW	5	143362639	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ATGGAGACCCCTGACCAAAG -3'
(R):5'- AAGCCAACCTTGATGACCTATTGC -3'

Sequencing Primer
(F):5'- CTGACCAAAGTTTTCCAGATGCAG -3'
(R):5'- CAACCTTGATGACCTATTGCACATG -3'

Posted On

2018-03-15