Incidental Mutation 'R6274:Grid2ip'
ID507521
Institutional Source Beutler Lab
Gene Symbol Grid2ip
Ensembl Gene ENSMUSG00000010825
Gene Nameglutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1
Synonymsdelphilin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R6274 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location143357338-143392152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 143380429 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 379 (S379N)
Ref Sequence ENSEMBL: ENSMUSP00000010969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010969] [ENSMUST00000110733] [ENSMUST00000120825]
Predicted Effect probably damaging
Transcript: ENSMUST00000010969
AA Change: S379N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000010969
Gene: ENSMUSG00000010825
AA Change: S379N

DomainStartEndE-ValueType
low complexity region 30 55 N/A INTRINSIC
low complexity region 57 73 N/A INTRINSIC
low complexity region 78 92 N/A INTRINSIC
PDZ 97 166 9.5e-16 SMART
low complexity region 256 272 N/A INTRINSIC
low complexity region 284 304 N/A INTRINSIC
low complexity region 429 446 N/A INTRINSIC
low complexity region 464 478 N/A INTRINSIC
low complexity region 536 584 N/A INTRINSIC
low complexity region 607 625 N/A INTRINSIC
FH2 633 1022 1.39e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110733
AA Change: S558N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106361
Gene: ENSMUSG00000010825
AA Change: S558N

DomainStartEndE-ValueType
PDZ 10 80 1.13e-13 SMART
low complexity region 98 109 N/A INTRINSIC
low complexity region 209 234 N/A INTRINSIC
low complexity region 236 252 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
PDZ 276 345 9.5e-16 SMART
low complexity region 435 451 N/A INTRINSIC
low complexity region 463 483 N/A INTRINSIC
low complexity region 608 625 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
low complexity region 715 763 N/A INTRINSIC
low complexity region 786 804 N/A INTRINSIC
FH2 812 1201 1.39e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120825
AA Change: S386N

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113443
Gene: ENSMUSG00000010825
AA Change: S386N

DomainStartEndE-ValueType
low complexity region 37 62 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
PDZ 104 173 9.5e-16 SMART
low complexity region 263 279 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 543 591 N/A INTRINSIC
low complexity region 614 632 N/A INTRINSIC
FH2 640 1029 1.39e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196148
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamate receptor delta-2 (GRID2; MIM 602368) is predominantly expressed at parallel fiber-Purkinje cell postsynapses and plays crucial roles in synaptogenesis and synaptic plasticity. GRID2IP1 interacts with GRID2 and may control GRID2 signaling in Purkinje cells (Matsuda et al., 2006 [PubMed 16835239]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display facilitated long-term depression induction at parallel fiber-Purkinje cell synapses as well as enhanced optokinetic response adaptation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ano1 A T 7: 144,618,863 S528T probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Bcl2l10 T C 9: 75,351,072 I172T possibly damaging Het
Bpifb3 A T 2: 153,929,323 N385I possibly damaging Het
Bsnd A G 4: 106,486,635 V158A probably damaging Het
Cacna1s A G 1: 136,089,045 N481S probably benign Het
Cdk5rap1 A G 2: 154,368,241 V138A probably damaging Het
Cep290 A G 10: 100,530,207 E1099G probably damaging Het
Cers1 T A 8: 70,331,077 L225Q probably damaging Het
Cfb T C 17: 34,862,093 Q7R probably benign Het
Clk4 A G 11: 51,271,921 S98G possibly damaging Het
Clock A G 5: 76,237,153 S406P probably benign Het
Csmd3 T C 15: 47,621,437 I3178V probably benign Het
Dock10 A G 1: 80,538,823 S1397P probably damaging Het
Fer1l4 A G 2: 156,029,268 L1421P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Greb1 G T 12: 16,735,151 T91K probably damaging Het
Gucy1b2 A T 14: 62,415,939 C336S probably damaging Het
Hdac1 A G 4: 129,519,109 C261R probably damaging Het
Hrasls5 C T 19: 7,637,466 T231I probably damaging Het
Htt T C 5: 34,852,087 S1471P possibly damaging Het
Ice1 A G 13: 70,594,839 V2134A probably damaging Het
Ikzf1 C T 11: 11,768,961 Q310* probably null Het
Il3ra G A 14: 14,350,180 V112I probably benign Het
Kif21b A G 1: 136,149,418 I393V possibly damaging Het
Krt74 T C 15: 101,763,437 noncoding transcript Het
Krtap29-1 T C 11: 99,978,983 N24S probably null Het
Mut T C 17: 40,956,245 V570A probably benign Het
Myh7 T C 14: 54,979,486 D1138G probably damaging Het
Nktr T C 9: 121,731,565 I125T probably damaging Het
Nlrp2 A T 7: 5,317,555 L861Q probably damaging Het
Notch3 C A 17: 32,147,290 R990L probably benign Het
Nrap T C 19: 56,361,721 D655G probably benign Het
Olfr1329 A T 4: 118,917,230 V79E probably benign Het
Olfr1451 G A 19: 12,999,870 V295I probably damaging Het
Osbpl11 T A 16: 33,227,056 I463N probably damaging Het
Pcsk6 A T 7: 66,033,844 R749W probably damaging Het
Plxnb1 T C 9: 109,112,141 probably null Het
Polr1a T A 6: 71,954,890 probably null Het
Ppm1g T C 5: 31,206,406 I153V probably damaging Het
Ppp1r12a T C 10: 108,260,890 S191P probably benign Het
Prodh T C 16: 18,081,058 K178E possibly damaging Het
Rilpl2 A G 5: 124,469,848 V103A possibly damaging Het
Sap18b C T 8: 95,825,541 H60Y probably benign Het
Sclt1 A G 3: 41,629,516 probably null Het
Serpinb1a G T 13: 32,842,866 H364Q probably damaging Het
Sez6l G A 5: 112,475,365 Q107* probably null Het
Sipa1l2 C T 8: 125,469,872 V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Uaca T A 9: 60,850,291 probably null Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Usp9y C T Y: 1,316,735 R1938H probably damaging Homo
Wnk4 C T 11: 101,265,431 R42W probably damaging Het
Zfp326 T A 5: 105,905,980 L242Q probably damaging Het
Other mutations in Grid2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02271:Grid2ip APN 5 143388909 missense probably benign
IGL02894:Grid2ip APN 5 143391108 missense probably benign 0.04
R0024:Grid2ip UTSW 5 143391041 missense probably damaging 1.00
R0355:Grid2ip UTSW 5 143357897 missense probably benign 0.10
R0403:Grid2ip UTSW 5 143357620 missense possibly damaging 0.84
R0523:Grid2ip UTSW 5 143373043 missense possibly damaging 0.85
R0605:Grid2ip UTSW 5 143379362 missense probably damaging 0.99
R0664:Grid2ip UTSW 5 143363977 critical splice donor site probably null
R1116:Grid2ip UTSW 5 143382914 missense possibly damaging 0.96
R1251:Grid2ip UTSW 5 143386015 missense possibly damaging 0.69
R1381:Grid2ip UTSW 5 143362651 missense probably benign 0.00
R1384:Grid2ip UTSW 5 143386096 critical splice donor site probably null
R1477:Grid2ip UTSW 5 143375585 missense probably damaging 1.00
R2266:Grid2ip UTSW 5 143386092 missense probably benign 0.01
R2267:Grid2ip UTSW 5 143386092 missense probably benign 0.01
R2304:Grid2ip UTSW 5 143387840 missense probably damaging 1.00
R2871:Grid2ip UTSW 5 143357929 missense probably benign
R2871:Grid2ip UTSW 5 143357929 missense probably benign
R2873:Grid2ip UTSW 5 143357929 missense probably benign
R2874:Grid2ip UTSW 5 143357929 missense probably benign
R3196:Grid2ip UTSW 5 143388178 missense probably damaging 0.99
R3622:Grid2ip UTSW 5 143386019 missense probably damaging 1.00
R3930:Grid2ip UTSW 5 143386039 missense probably damaging 1.00
R4628:Grid2ip UTSW 5 143382875 missense probably damaging 1.00
R4696:Grid2ip UTSW 5 143391376 intron probably benign
R4709:Grid2ip UTSW 5 143388903 missense probably damaging 1.00
R4772:Grid2ip UTSW 5 143375700 missense possibly damaging 0.91
R4838:Grid2ip UTSW 5 143388775 nonsense probably null
R4857:Grid2ip UTSW 5 143382629 missense probably damaging 1.00
R5243:Grid2ip UTSW 5 143377505 missense probably damaging 1.00
R5894:Grid2ip UTSW 5 143388911 missense probably damaging 1.00
R6014:Grid2ip UTSW 5 143387823 missense possibly damaging 0.84
R6076:Grid2ip UTSW 5 143387375 missense probably benign 0.17
R6209:Grid2ip UTSW 5 143380429 missense probably damaging 1.00
R6257:Grid2ip UTSW 5 143380429 missense probably damaging 1.00
R6439:Grid2ip UTSW 5 143373502 missense probably damaging 0.99
R7098:Grid2ip UTSW 5 143357591 missense probably damaging 0.97
R7405:Grid2ip UTSW 5 143380444 missense probably benign 0.03
R7652:Grid2ip UTSW 5 143382638 missense probably damaging 1.00
R8259:Grid2ip UTSW 5 143362589 missense probably benign 0.20
R8261:Grid2ip UTSW 5 143381940 critical splice donor site probably null
R8350:Grid2ip UTSW 5 143377518 missense probably damaging 1.00
R8391:Grid2ip UTSW 5 143380196 missense probably damaging 0.98
X0010:Grid2ip UTSW 5 143357878 missense probably benign 0.01
X0012:Grid2ip UTSW 5 143362639 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATGGAGACCCCTGACCAAAG -3'
(R):5'- AAGCCAACCTTGATGACCTATTGC -3'

Sequencing Primer
(F):5'- CTGACCAAAGTTTTCCAGATGCAG -3'
(R):5'- CAACCTTGATGACCTATTGCACATG -3'
Posted On2018-03-15