Mutagenetix > Incidental Mutation

Incidental Mutation 'R6274:Nlrp2'

507523

Institutional Source

Beutler Lab

Gene Symbol

Nlrp2

Ensembl Gene

ENSMUSG00000035177

Gene Name

NLR family, pyrin domain containing 2

Synonyms

Nbs1, Pan1, PYPAF2, E330007A02Rik, Nalp2

MMRRC Submission

044444-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6274 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

5298547-5351035 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 5317555 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 861 (L861Q)

Ref Sequence

ENSEMBL: ENSMUSP00000045077 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045022] [ENSMUST00000207520] [ENSMUST00000207685]

AlphaFold

Q4PLS0

Predicted Effect

probably damaging
Transcript: ENSMUST00000045022
AA Change: L861Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: L861Q

Domain	Start	End	E-Value	Type
PYRIN	7	90	2.88e-17	SMART
Pfam:NACHT	180	348	6.9e-30	PFAM
internal_repeat_1	676	722	1.74e-5	PROSPERO
LRR	796	823	1.26e1	SMART
LRR	825	852	1.18e1	SMART
LRR	853	880	5.81e-2	SMART
LRR	882	909	3.39e-3	SMART
LRR	910	937	5.06e-2	SMART
LRR	939	966	5.23e0	SMART
LRR	967	994	3.58e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000207520

Predicted Effect

probably benign
Transcript: ENSMUST00000207685

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.1%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ano1	A	T	7: 144,618,863	S528T	probably benign	Het
Araf	G	T	X: 20,860,100	R601L	probably damaging	Homo
Bcl2l10	T	C	9: 75,351,072	I172T	possibly damaging	Het
Bpifb3	A	T	2: 153,929,323	N385I	possibly damaging	Het
Bsnd	A	G	4: 106,486,635	V158A	probably damaging	Het
Cacna1s	A	G	1: 136,089,045	N481S	probably benign	Het
Cdk5rap1	A	G	2: 154,368,241	V138A	probably damaging	Het
Cep290	A	G	10: 100,530,207	E1099G	probably damaging	Het
Cers1	T	A	8: 70,331,077	L225Q	probably damaging	Het
Cfb	T	C	17: 34,862,093	Q7R	probably benign	Het
Clk4	A	G	11: 51,271,921	S98G	possibly damaging	Het
Clock	A	G	5: 76,237,153	S406P	probably benign	Het
Csmd3	T	C	15: 47,621,437	I3178V	probably benign	Het
Dock10	A	G	1: 80,538,823	S1397P	probably damaging	Het
Fer1l4	A	G	2: 156,029,268	L1421P	probably damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Greb1	G	T	12: 16,735,151	T91K	probably damaging	Het
Grid2ip	G	A	5: 143,380,429	S379N	probably damaging	Het
Gucy1b2	A	T	14: 62,415,939	C336S	probably damaging	Het
Hdac1	A	G	4: 129,519,109	C261R	probably damaging	Het
Hrasls5	C	T	19: 7,637,466	T231I	probably damaging	Het
Htt	T	C	5: 34,852,087	S1471P	possibly damaging	Het
Ice1	A	G	13: 70,594,839	V2134A	probably damaging	Het
Ikzf1	C	T	11: 11,768,961	Q310*	probably null	Het
Il3ra	G	A	14: 14,350,180	V112I	probably benign	Het
Kif21b	A	G	1: 136,149,418	I393V	possibly damaging	Het
Krt74	T	C	15: 101,763,437		noncoding transcript	Het
Krtap29-1	T	C	11: 99,978,983	N24S	probably null	Het
Mut	T	C	17: 40,956,245	V570A	probably benign	Het
Myh7	T	C	14: 54,979,486	D1138G	probably damaging	Het
Nktr	T	C	9: 121,731,565	I125T	probably damaging	Het
Notch3	C	A	17: 32,147,290	R990L	probably benign	Het
Nrap	T	C	19: 56,361,721	D655G	probably benign	Het
Olfr1329	A	T	4: 118,917,230	V79E	probably benign	Het
Olfr1451	G	A	19: 12,999,870	V295I	probably damaging	Het
Osbpl11	T	A	16: 33,227,056	I463N	probably damaging	Het
Pcsk6	A	T	7: 66,033,844	R749W	probably damaging	Het
Plxnb1	T	C	9: 109,112,141		probably null	Het
Polr1a	T	A	6: 71,954,890		probably null	Het
Ppm1g	T	C	5: 31,206,406	I153V	probably damaging	Het
Ppp1r12a	T	C	10: 108,260,890	S191P	probably benign	Het
Prodh	T	C	16: 18,081,058	K178E	possibly damaging	Het
Rilpl2	A	G	5: 124,469,848	V103A	possibly damaging	Het
Sap18b	C	T	8: 95,825,541	H60Y	probably benign	Het
Sclt1	A	G	3: 41,629,516		probably null	Het
Serpinb1a	G	T	13: 32,842,866	H364Q	probably damaging	Het
Sez6l	G	A	5: 112,475,365	Q107*	probably null	Het
Sipa1l2	C	T	8: 125,469,872	V708I	probably damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Uaca	T	A	9: 60,850,291		probably null	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Usp9y	C	T	Y: 1,316,735	R1938H	probably damaging	Homo
Wnk4	C	T	11: 101,265,431	R42W	probably damaging	Het
Zfp326	T	A	5: 105,905,980	L242Q	probably damaging	Het

Other mutations in Nlrp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Nlrp2	APN	7	5337548	missense	probably benign	0.00
IGL00545:Nlrp2	APN	7	5328252	missense	possibly damaging	0.89
IGL01311:Nlrp2	APN	7	5319239	missense	possibly damaging	0.92
IGL01345:Nlrp2	APN	7	5317492	missense	probably benign	0.16
IGL01583:Nlrp2	APN	7	5337770	missense	probably damaging	1.00
IGL01659:Nlrp2	APN	7	5328035	missense	probably damaging	1.00
IGL02240:Nlrp2	APN	7	5327823	missense	probably damaging	1.00
IGL02353:Nlrp2	APN	7	5337599	missense	probably damaging	1.00
IGL02360:Nlrp2	APN	7	5337599	missense	probably damaging	1.00
IGL02399:Nlrp2	APN	7	5328810	missense	probably damaging	1.00
IGL02441:Nlrp2	APN	7	5335567	critical splice donor site	probably null
IGL02588:Nlrp2	APN	7	5327552	nonsense	probably null
IGL02803:Nlrp2	APN	7	5328318	missense	probably damaging	1.00
IGL02968:Nlrp2	APN	7	5301025	missense	possibly damaging	0.81
IGL03342:Nlrp2	APN	7	5317483	missense	probably damaging	1.00
BB006:Nlrp2	UTSW	7	5327499	missense	probably damaging	1.00
BB016:Nlrp2	UTSW	7	5327499	missense	probably damaging	1.00
R0027:Nlrp2	UTSW	7	5322448	missense	probably damaging	1.00
R0051:Nlrp2	UTSW	7	5322334	unclassified	probably benign
R0079:Nlrp2	UTSW	7	5327730	missense	possibly damaging	0.81
R0130:Nlrp2	UTSW	7	5322418	missense	possibly damaging	0.77
R0157:Nlrp2	UTSW	7	5308770	missense	possibly damaging	0.88
R0201:Nlrp2	UTSW	7	5328329	missense	probably benign	0.00
R0276:Nlrp2	UTSW	7	5328109	missense	probably benign	0.00
R0288:Nlrp2	UTSW	7	5328545	missense	probably benign	0.19
R0332:Nlrp2	UTSW	7	5317630	missense	probably damaging	1.00
R0724:Nlrp2	UTSW	7	5319222	missense	probably damaging	1.00
R1241:Nlrp2	UTSW	7	5328431	missense	probably damaging	1.00
R1355:Nlrp2	UTSW	7	5327491	missense	possibly damaging	0.81
R1392:Nlrp2	UTSW	7	5329015	splice site	probably benign
R1470:Nlrp2	UTSW	7	5300951	missense	probably benign	0.18
R1470:Nlrp2	UTSW	7	5300951	missense	probably benign	0.18
R1563:Nlrp2	UTSW	7	5308725	missense	probably damaging	1.00
R1866:Nlrp2	UTSW	7	5327716	nonsense	probably null
R1942:Nlrp2	UTSW	7	5322448	missense	probably damaging	1.00
R1959:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R1960:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R1961:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R2072:Nlrp2	UTSW	7	5325006	missense	probably damaging	1.00
R2161:Nlrp2	UTSW	7	5325042	missense	probably damaging	1.00
R2190:Nlrp2	UTSW	7	5319238	missense	possibly damaging	0.95
R2243:Nlrp2	UTSW	7	5335598	missense	probably benign	0.03
R2277:Nlrp2	UTSW	7	5328129	missense	probably benign
R2334:Nlrp2	UTSW	7	5337535	missense	probably benign	0.39
R3030:Nlrp2	UTSW	7	5327748	missense	probably damaging	1.00
R3404:Nlrp2	UTSW	7	5319287	missense	probably benign	0.01
R3941:Nlrp2	UTSW	7	5327552	nonsense	probably null
R4021:Nlrp2	UTSW	7	5325012	missense	probably benign	0.40
R4518:Nlrp2	UTSW	7	5325056	missense	possibly damaging	0.85
R4666:Nlrp2	UTSW	7	5319189	missense	probably benign	0.18
R4767:Nlrp2	UTSW	7	5328024	missense	probably damaging	1.00
R4827:Nlrp2	UTSW	7	5328951	missense	possibly damaging	0.60
R4873:Nlrp2	UTSW	7	5298859	missense	probably benign	0.09
R4875:Nlrp2	UTSW	7	5298859	missense	probably benign	0.09
R5020:Nlrp2	UTSW	7	5328077	missense	probably damaging	1.00
R5293:Nlrp2	UTSW	7	5327615	missense	probably damaging	1.00
R5310:Nlrp2	UTSW	7	5325008	missense	probably benign	0.00
R5336:Nlrp2	UTSW	7	5328119	missense	probably benign
R5390:Nlrp2	UTSW	7	5300909	missense	probably benign	0.00
R5864:Nlrp2	UTSW	7	5322381	missense	probably damaging	1.00
R5913:Nlrp2	UTSW	7	5324903	splice site	probably null
R6173:Nlrp2	UTSW	7	5337809	missense	probably damaging	0.96
R6303:Nlrp2	UTSW	7	5337761	missense	probably damaging	1.00
R6343:Nlrp2	UTSW	7	5300926	missense	possibly damaging	0.82
R6704:Nlrp2	UTSW	7	5325041	nonsense	probably null
R6814:Nlrp2	UTSW	7	5308710	missense	probably benign	0.01
R6872:Nlrp2	UTSW	7	5308710	missense	probably benign	0.01
R7023:Nlrp2	UTSW	7	5328229	nonsense	probably null
R7028:Nlrp2	UTSW	7	5328572	missense	possibly damaging	0.93
R7109:Nlrp2	UTSW	7	5328617	missense	probably damaging	1.00
R7203:Nlrp2	UTSW	7	5317534	missense	probably damaging	1.00
R7322:Nlrp2	UTSW	7	5308645	missense	possibly damaging	0.94
R7339:Nlrp2	UTSW	7	5327628	missense	possibly damaging	0.95
R7573:Nlrp2	UTSW	7	5317469	critical splice donor site	probably null
R7657:Nlrp2	UTSW	7	5319168	missense	probably benign	0.01
R7929:Nlrp2	UTSW	7	5327499	missense	probably damaging	1.00
R7964:Nlrp2	UTSW	7	5328528	missense	probably damaging	1.00
R8097:Nlrp2	UTSW	7	5327651	missense	probably damaging	1.00
R8276:Nlrp2	UTSW	7	5317495	missense	probably benign	0.40
R8785:Nlrp2	UTSW	7	5327549	missense	probably damaging	0.99
R8798:Nlrp2	UTSW	7	5327888	missense	possibly damaging	0.86
R8982:Nlrp2	UTSW	7	5324979	missense	probably damaging	1.00
R9030:Nlrp2	UTSW	7	5322458	missense	probably null	0.00
R9038:Nlrp2	UTSW	7	5327479	missense	probably benign	0.14
R9149:Nlrp2	UTSW	7	5327573	missense	probably benign	0.01
R9229:Nlrp2	UTSW	7	5301053	missense	possibly damaging	0.81
R9584:Nlrp2	UTSW	7	5319216	missense	probably damaging	1.00
X0027:Nlrp2	UTSW	7	5327642	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGTCTCTCTGTCTCTCTATCTCTC -3'
(R):5'- CTGGCATTCTTTCCTCCACCT -3'

Sequencing Primer
(F):5'- TCTCTCTCTCTCACACACACACATAC -3'
(R):5'- CTATGTGTTGAACCCTGATAGGCTC -3'

Posted On

2018-03-15