Mutagenetix > Incidental Mutation

Incidental Mutation 'R6274:Cers1'

507526

Institutional Source

Beutler Lab

Gene Symbol

Cers1

Ensembl Gene

ENSMUSG00000087408

Gene Name

ceramide synthase 1

Synonyms

CerS1, to, Uog-1, Lass1

MMRRC Submission

044444-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.274) question?

Stock #

R6274 (G1)

Quality Score

109.008

Status

Validated

Chromosome

Chromosomal Location

70315775-70331592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 70331077 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 225 (L225Q)

Ref Sequence

ENSEMBL: ENSMUSP00000146749 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000140239] [ENSMUST00000165819] [ENSMUST00000207684] [ENSMUST00000215817]

AlphaFold

P20863
P27545

Predicted Effect

probably benign
Transcript: ENSMUST00000075666

SMART Domains

Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301

Domain	Start	End	E-Value	Type
low complexity region	47	67	N/A	INTRINSIC
low complexity region	101	110	N/A	INTRINSIC
Pfam:UPF1_Zn_bind	116	267	4.1e-78	PFAM
Pfam:ResIII	475	617	1.3e-6	PFAM
Pfam:AAA_11	476	600	4.5e-24	PFAM
Pfam:AAA_30	476	688	5.6e-13	PFAM
Pfam:AAA_19	483	559	3.8e-16	PFAM
Pfam:AAA_11	576	679	7.7e-30	PFAM
Pfam:AAA_12	686	883	3.3e-64	PFAM
low complexity region	995	1001	N/A	INTRINSIC
low complexity region	1013	1028	N/A	INTRINSIC
low complexity region	1066	1081	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140239

SMART Domains

Protein: ENSMUSP00000120598
Gene: ENSMUSG00000087408

Domain	Start	End	E-Value	Type
low complexity region	49	68	N/A	INTRINSIC
TLC	97	311	1.24e-57	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000165819
AA Change: L225Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000128325
Gene: ENSMUSG00000087408
AA Change: L225Q

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:TGFb_propeptide	33	169	7e-16	PFAM
low complexity region	225	237	N/A	INTRINSIC
TGFB	251	357	6.22e-56	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000207684
AA Change: L225Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000215817

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.1%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: This gene encodes a ceramide synthase enzyme, which catalyzes the synthesis of ceramide, the hydrophobic moiety of sphingolipids. The encoded enzyme synthesizes 18-carbon (C18) ceramide in brain neurons. Mice lacking a functional copy of this gene exhibit impaired cerebellar development, locomotion and motor coordination. This protein is transcribed from a bicistronic mRNA, which also encodes growth differentiation factor 1. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for the spontaneous toppler mutation display reduced body and brain weight, a small cerebellum, progressive tremors, ataxia, impaired balance and seizures, as well as dramatic dendritic changes and severe loss of Purkinje cells, glial changes, and a shortened lifespan. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ano1	A	T	7: 144,618,863	S528T	probably benign	Het
Araf	G	T	X: 20,860,100	R601L	probably damaging	Homo
Bcl2l10	T	C	9: 75,351,072	I172T	possibly damaging	Het
Bpifb3	A	T	2: 153,929,323	N385I	possibly damaging	Het
Bsnd	A	G	4: 106,486,635	V158A	probably damaging	Het
Cacna1s	A	G	1: 136,089,045	N481S	probably benign	Het
Cdk5rap1	A	G	2: 154,368,241	V138A	probably damaging	Het
Cep290	A	G	10: 100,530,207	E1099G	probably damaging	Het
Cfb	T	C	17: 34,862,093	Q7R	probably benign	Het
Clk4	A	G	11: 51,271,921	S98G	possibly damaging	Het
Clock	A	G	5: 76,237,153	S406P	probably benign	Het
Csmd3	T	C	15: 47,621,437	I3178V	probably benign	Het
Dock10	A	G	1: 80,538,823	S1397P	probably damaging	Het
Fer1l4	A	G	2: 156,029,268	L1421P	probably damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Greb1	G	T	12: 16,735,151	T91K	probably damaging	Het
Grid2ip	G	A	5: 143,380,429	S379N	probably damaging	Het
Gucy1b2	A	T	14: 62,415,939	C336S	probably damaging	Het
Hdac1	A	G	4: 129,519,109	C261R	probably damaging	Het
Hrasls5	C	T	19: 7,637,466	T231I	probably damaging	Het
Htt	T	C	5: 34,852,087	S1471P	possibly damaging	Het
Ice1	A	G	13: 70,594,839	V2134A	probably damaging	Het
Ikzf1	C	T	11: 11,768,961	Q310*	probably null	Het
Il3ra	G	A	14: 14,350,180	V112I	probably benign	Het
Kif21b	A	G	1: 136,149,418	I393V	possibly damaging	Het
Krt74	T	C	15: 101,763,437		noncoding transcript	Het
Krtap29-1	T	C	11: 99,978,983	N24S	probably null	Het
Mut	T	C	17: 40,956,245	V570A	probably benign	Het
Myh7	T	C	14: 54,979,486	D1138G	probably damaging	Het
Nktr	T	C	9: 121,731,565	I125T	probably damaging	Het
Nlrp2	A	T	7: 5,317,555	L861Q	probably damaging	Het
Notch3	C	A	17: 32,147,290	R990L	probably benign	Het
Nrap	T	C	19: 56,361,721	D655G	probably benign	Het
Olfr1329	A	T	4: 118,917,230	V79E	probably benign	Het
Olfr1451	G	A	19: 12,999,870	V295I	probably damaging	Het
Osbpl11	T	A	16: 33,227,056	I463N	probably damaging	Het
Pcsk6	A	T	7: 66,033,844	R749W	probably damaging	Het
Plxnb1	T	C	9: 109,112,141		probably null	Het
Polr1a	T	A	6: 71,954,890		probably null	Het
Ppm1g	T	C	5: 31,206,406	I153V	probably damaging	Het
Ppp1r12a	T	C	10: 108,260,890	S191P	probably benign	Het
Prodh	T	C	16: 18,081,058	K178E	possibly damaging	Het
Rilpl2	A	G	5: 124,469,848	V103A	possibly damaging	Het
Sap18b	C	T	8: 95,825,541	H60Y	probably benign	Het
Sclt1	A	G	3: 41,629,516		probably null	Het
Serpinb1a	G	T	13: 32,842,866	H364Q	probably damaging	Het
Sez6l	G	A	5: 112,475,365	Q107*	probably null	Het
Sipa1l2	C	T	8: 125,469,872	V708I	probably damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Uaca	T	A	9: 60,850,291		probably null	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Usp9y	C	T	Y: 1,316,735	R1938H	probably damaging	Homo
Wnk4	C	T	11: 101,265,431	R42W	probably damaging	Het
Zfp326	T	A	5: 105,905,980	L242Q	probably damaging	Het

Other mutations in Cers1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01559:Cers1	APN	8	70323233	missense	probably damaging	1.00
IGL01982:Cers1	APN	8	70323431	missense	probably damaging	0.99
IGL02827:Cers1	APN	8	70321527	missense	probably damaging	1.00
R1025:Cers1	UTSW	8	70321536	missense	probably benign	0.44
R1456:Cers1	UTSW	8	70331188	missense	probably damaging	1.00
R1467:Cers1	UTSW	8	70323169	missense	possibly damaging	0.89
R1467:Cers1	UTSW	8	70323169	missense	possibly damaging	0.89
R1764:Cers1	UTSW	8	70321491	splice site	probably null
R2397:Cers1	UTSW	8	70321536	missense	probably benign	0.44
R3107:Cers1	UTSW	8	70322636	missense	probably benign	0.30
R3808:Cers1	UTSW	8	70330010	missense	possibly damaging	0.85
R3809:Cers1	UTSW	8	70330010	missense	possibly damaging	0.85
R4789:Cers1	UTSW	8	70323368	missense	probably damaging	0.96
R5450:Cers1	UTSW	8	70318297	missense	probably damaging	0.99
R5987:Cers1	UTSW	8	70321578	missense	possibly damaging	0.78
R6535:Cers1	UTSW	8	70330154	missense	probably damaging	1.00
R7060:Cers1	UTSW	8	70315905	missense	possibly damaging	0.86
R7152:Cers1	UTSW	8	70318251	missense	probably damaging	1.00
R8338:Cers1	UTSW	8	70331122	missense	possibly damaging	0.92
R8371:Cers1	UTSW	8	70329573	missense	probably benign
R8524:Cers1	UTSW	8	70331248	missense	probably damaging	1.00
Z1176:Cers1	UTSW	8	70318318	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- TTGACCTGTCGAATGTGGAGC -3'
(R):5'- ATGGGTGATAGACGCTCTGG -3'

Sequencing Primer
(F):5'- AGCTAAGCGTGGCACTGTG -3'
(R):5'- TGATAGACGCTCTGGCACGC -3'

Posted On

2018-03-15