Incidental Mutation 'R6274:Cers1'
ID507526
Institutional Source Beutler Lab
Gene Symbol Cers1
Ensembl Gene ENSMUSG00000087408
Gene Nameceramide synthase 1
SynonymsCerS1, to, Uog-1, Lass1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.523) question?
Stock #R6274 (G1)
Quality Score109.008
Status Validated
Chromosome8
Chromosomal Location70315775-70331592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70331077 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 225 (L225Q)
Ref Sequence ENSEMBL: ENSMUSP00000146749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000140239] [ENSMUST00000165819] [ENSMUST00000207684] [ENSMUST00000215817]
Predicted Effect probably benign
Transcript: ENSMUST00000075666
SMART Domains Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
Pfam:UPF1_Zn_bind 116 267 4.1e-78 PFAM
Pfam:ResIII 475 617 1.3e-6 PFAM
Pfam:AAA_11 476 600 4.5e-24 PFAM
Pfam:AAA_30 476 688 5.6e-13 PFAM
Pfam:AAA_19 483 559 3.8e-16 PFAM
Pfam:AAA_11 576 679 7.7e-30 PFAM
Pfam:AAA_12 686 883 3.3e-64 PFAM
low complexity region 995 1001 N/A INTRINSIC
low complexity region 1013 1028 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140239
SMART Domains Protein: ENSMUSP00000120598
Gene: ENSMUSG00000087408

DomainStartEndE-ValueType
low complexity region 49 68 N/A INTRINSIC
TLC 97 311 1.24e-57 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165819
AA Change: L225Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128325
Gene: ENSMUSG00000087408
AA Change: L225Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:TGFb_propeptide 33 169 7e-16 PFAM
low complexity region 225 237 N/A INTRINSIC
TGFB 251 357 6.22e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207684
AA Change: L225Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000215817
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes a ceramide synthase enzyme, which catalyzes the synthesis of ceramide, the hydrophobic moiety of sphingolipids. The encoded enzyme synthesizes 18-carbon (C18) ceramide in brain neurons. Mice lacking a functional copy of this gene exhibit impaired cerebellar development, locomotion and motor coordination. This protein is transcribed from a bicistronic mRNA, which also encodes growth differentiation factor 1. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for the spontaneous toppler mutation display reduced body and brain weight, a small cerebellum, progressive tremors, ataxia, impaired balance and seizures, as well as dramatic dendritic changes and severe loss of Purkinje cells, glial changes, and a shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ano1 A T 7: 144,618,863 S528T probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Bcl2l10 T C 9: 75,351,072 I172T possibly damaging Het
Bpifb3 A T 2: 153,929,323 N385I possibly damaging Het
Bsnd A G 4: 106,486,635 V158A probably damaging Het
Cacna1s A G 1: 136,089,045 N481S probably benign Het
Cdk5rap1 A G 2: 154,368,241 V138A probably damaging Het
Cep290 A G 10: 100,530,207 E1099G probably damaging Het
Cfb T C 17: 34,862,093 Q7R probably benign Het
Clk4 A G 11: 51,271,921 S98G possibly damaging Het
Clock A G 5: 76,237,153 S406P probably benign Het
Csmd3 T C 15: 47,621,437 I3178V probably benign Het
Dock10 A G 1: 80,538,823 S1397P probably damaging Het
Fer1l4 A G 2: 156,029,268 L1421P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Greb1 G T 12: 16,735,151 T91K probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
Gucy1b2 A T 14: 62,415,939 C336S probably damaging Het
Hdac1 A G 4: 129,519,109 C261R probably damaging Het
Hrasls5 C T 19: 7,637,466 T231I probably damaging Het
Htt T C 5: 34,852,087 S1471P possibly damaging Het
Ice1 A G 13: 70,594,839 V2134A probably damaging Het
Ikzf1 C T 11: 11,768,961 Q310* probably null Het
Il3ra G A 14: 14,350,180 V112I probably benign Het
Kif21b A G 1: 136,149,418 I393V possibly damaging Het
Krt74 T C 15: 101,763,437 noncoding transcript Het
Krtap29-1 T C 11: 99,978,983 N24S probably null Het
Mut T C 17: 40,956,245 V570A probably benign Het
Myh7 T C 14: 54,979,486 D1138G probably damaging Het
Nktr T C 9: 121,731,565 I125T probably damaging Het
Nlrp2 A T 7: 5,317,555 L861Q probably damaging Het
Notch3 C A 17: 32,147,290 R990L probably benign Het
Nrap T C 19: 56,361,721 D655G probably benign Het
Olfr1329 A T 4: 118,917,230 V79E probably benign Het
Olfr1451 G A 19: 12,999,870 V295I probably damaging Het
Osbpl11 T A 16: 33,227,056 I463N probably damaging Het
Pcsk6 A T 7: 66,033,844 R749W probably damaging Het
Plxnb1 T C 9: 109,112,141 probably null Het
Polr1a T A 6: 71,954,890 probably null Het
Ppm1g T C 5: 31,206,406 I153V probably damaging Het
Ppp1r12a T C 10: 108,260,890 S191P probably benign Het
Prodh T C 16: 18,081,058 K178E possibly damaging Het
Rilpl2 A G 5: 124,469,848 V103A possibly damaging Het
Sap18b C T 8: 95,825,541 H60Y probably benign Het
Sclt1 A G 3: 41,629,516 probably null Het
Serpinb1a G T 13: 32,842,866 H364Q probably damaging Het
Sez6l G A 5: 112,475,365 Q107* probably null Het
Sipa1l2 C T 8: 125,469,872 V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Uaca T A 9: 60,850,291 probably null Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Usp9y C T Y: 1,316,735 R1938H probably damaging Homo
Wnk4 C T 11: 101,265,431 R42W probably damaging Het
Zfp326 T A 5: 105,905,980 L242Q probably damaging Het
Other mutations in Cers1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01559:Cers1 APN 8 70323233 missense probably damaging 1.00
IGL01982:Cers1 APN 8 70323431 missense probably damaging 0.99
IGL02827:Cers1 APN 8 70321527 missense probably damaging 1.00
R1025:Cers1 UTSW 8 70321536 missense probably benign 0.44
R1456:Cers1 UTSW 8 70331188 missense probably damaging 1.00
R1467:Cers1 UTSW 8 70323169 missense possibly damaging 0.89
R1467:Cers1 UTSW 8 70323169 missense possibly damaging 0.89
R1764:Cers1 UTSW 8 70321491 splice site probably null
R2397:Cers1 UTSW 8 70321536 missense probably benign 0.44
R3107:Cers1 UTSW 8 70322636 missense probably benign 0.30
R3808:Cers1 UTSW 8 70330010 missense possibly damaging 0.85
R3809:Cers1 UTSW 8 70330010 missense possibly damaging 0.85
R4789:Cers1 UTSW 8 70323368 missense probably damaging 0.96
R5450:Cers1 UTSW 8 70318297 missense probably damaging 0.99
R5987:Cers1 UTSW 8 70321578 missense possibly damaging 0.78
R6535:Cers1 UTSW 8 70330154 missense probably damaging 1.00
R7060:Cers1 UTSW 8 70315905 missense possibly damaging 0.86
R7152:Cers1 UTSW 8 70318251 missense probably damaging 1.00
R8338:Cers1 UTSW 8 70331122 missense possibly damaging 0.92
R8371:Cers1 UTSW 8 70329573 missense probably benign
Z1176:Cers1 UTSW 8 70318318 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TTGACCTGTCGAATGTGGAGC -3'
(R):5'- ATGGGTGATAGACGCTCTGG -3'

Sequencing Primer
(F):5'- AGCTAAGCGTGGCACTGTG -3'
(R):5'- TGATAGACGCTCTGGCACGC -3'
Posted On2018-03-15