Incidental Mutation 'R6274:Sap18b'
ID 507527
Institutional Source Beutler Lab
Gene Symbol Sap18b
Ensembl Gene ENSMUSG00000061104
Gene Name Sin3-associated polypeptide 18B
Synonyms Gm10094
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.941) question?
Stock # R6274 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 95825346-95826134 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 95825541 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 60 (H60Y)
Ref Sequence ENSEMBL: ENSMUSP00000073697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074053]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000074053
AA Change: H60Y

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000073697
Gene: ENSMUSG00000061104
AA Change: H60Y

DomainStartEndE-ValueType
Pfam:SAP18 38 156 2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145562
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211921
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This intronless gene is highly similar to the multi-exon Sap18 gene on chromosome 14, whose product functions in transcriptional repression as a component of the Sin3 histone deacetylase complex. This gene may possibly be a Sap18 pseudogene, but it is represented as protein-coding because it appears to be transcribed and has an intact ORF that would result in a protein that is 100% identical to the Sap18 protein. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ano1 A T 7: 144,618,863 S528T probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Bcl2l10 T C 9: 75,351,072 I172T possibly damaging Het
Bpifb3 A T 2: 153,929,323 N385I possibly damaging Het
Bsnd A G 4: 106,486,635 V158A probably damaging Het
Cacna1s A G 1: 136,089,045 N481S probably benign Het
Cdk5rap1 A G 2: 154,368,241 V138A probably damaging Het
Cep290 A G 10: 100,530,207 E1099G probably damaging Het
Cers1 T A 8: 70,331,077 L225Q probably damaging Het
Cfb T C 17: 34,862,093 Q7R probably benign Het
Clk4 A G 11: 51,271,921 S98G possibly damaging Het
Clock A G 5: 76,237,153 S406P probably benign Het
Csmd3 T C 15: 47,621,437 I3178V probably benign Het
Dock10 A G 1: 80,538,823 S1397P probably damaging Het
Fer1l4 A G 2: 156,029,268 L1421P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Greb1 G T 12: 16,735,151 T91K probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
Gucy1b2 A T 14: 62,415,939 C336S probably damaging Het
Hdac1 A G 4: 129,519,109 C261R probably damaging Het
Hrasls5 C T 19: 7,637,466 T231I probably damaging Het
Htt T C 5: 34,852,087 S1471P possibly damaging Het
Ice1 A G 13: 70,594,839 V2134A probably damaging Het
Ikzf1 C T 11: 11,768,961 Q310* probably null Het
Il3ra G A 14: 14,350,180 V112I probably benign Het
Kif21b A G 1: 136,149,418 I393V possibly damaging Het
Krt74 T C 15: 101,763,437 noncoding transcript Het
Krtap29-1 T C 11: 99,978,983 N24S probably null Het
Mut T C 17: 40,956,245 V570A probably benign Het
Myh7 T C 14: 54,979,486 D1138G probably damaging Het
Nktr T C 9: 121,731,565 I125T probably damaging Het
Nlrp2 A T 7: 5,317,555 L861Q probably damaging Het
Notch3 C A 17: 32,147,290 R990L probably benign Het
Nrap T C 19: 56,361,721 D655G probably benign Het
Olfr1329 A T 4: 118,917,230 V79E probably benign Het
Olfr1451 G A 19: 12,999,870 V295I probably damaging Het
Osbpl11 T A 16: 33,227,056 I463N probably damaging Het
Pcsk6 A T 7: 66,033,844 R749W probably damaging Het
Plxnb1 T C 9: 109,112,141 probably null Het
Polr1a T A 6: 71,954,890 probably null Het
Ppm1g T C 5: 31,206,406 I153V probably damaging Het
Ppp1r12a T C 10: 108,260,890 S191P probably benign Het
Prodh T C 16: 18,081,058 K178E possibly damaging Het
Rilpl2 A G 5: 124,469,848 V103A possibly damaging Het
Sclt1 A G 3: 41,629,516 probably null Het
Serpinb1a G T 13: 32,842,866 H364Q probably damaging Het
Sez6l G A 5: 112,475,365 Q107* probably null Het
Sipa1l2 C T 8: 125,469,872 V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Uaca T A 9: 60,850,291 probably null Het
Uqcrc1 C A 9: 108,942,156 H95N probably damaging Het
Usp9y C T Y: 1,316,735 R1938H probably damaging Homo
Wnk4 C T 11: 101,265,431 R42W probably damaging Het
Zfp326 T A 5: 105,905,980 L242Q probably damaging Het
Other mutations in Sap18b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02939:Sap18b APN 8 95825701 missense probably benign 0.00
R1791:Sap18b UTSW 8 95825714 missense probably benign 0.00
R2358:Sap18b UTSW 8 95825563 missense probably benign 0.02
R3826:Sap18b UTSW 8 95825557 missense probably damaging 1.00
R4001:Sap18b UTSW 8 95825440 missense probably benign 0.04
R5374:Sap18b UTSW 8 95825370 missense unknown
R5596:Sap18b UTSW 8 95825370 missense unknown
R9626:Sap18b UTSW 8 95825470 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TGTCACAGGACTAGCTCATGC -3'
(R):5'- AGTCATCAGTGCCCTTCCTG -3'

Sequencing Primer
(F):5'- CGTTACCCAGGAGGAAATT -3'
(R):5'- AATCTCCTTAACTCGATATCCAGG -3'
Posted On 2018-03-15