Mutagenetix > Incidental Mutation

Incidental Mutation 'R6274:Sipa1l2'

507528

Institutional Source

Beutler Lab

Gene Symbol

Sipa1l2

Ensembl Gene

ENSMUSG00000001995

Gene Name

signal-induced proliferation-associated 1 like 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.313) question?

Stock #

R6274 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

125418063-125569808 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 125469872 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 708 (V708I)

Ref Sequence

ENSEMBL: ENSMUSP00000148536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108775] [ENSMUST00000212168] [ENSMUST00000212987]

AlphaFold

Q80TE4

Predicted Effect

probably damaging
Transcript: ENSMUST00000108775
AA Change: V708I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104405
Gene: ENSMUSG00000001995
AA Change: V708I

Domain	Start	End	E-Value	Type
low complexity region	53	64	N/A	INTRINSIC
low complexity region	163	172	N/A	INTRINSIC
low complexity region	261	272	N/A	INTRINSIC
low complexity region	427	449	N/A	INTRINSIC
Pfam:Rap_GAP	625	807	2.6e-67	PFAM
PDZ	960	1026	6.47e-9	SMART
low complexity region	1091	1103	N/A	INTRINSIC
low complexity region	1120	1138	N/A	INTRINSIC
low complexity region	1220	1238	N/A	INTRINSIC
low complexity region	1299	1312	N/A	INTRINSIC
low complexity region	1321	1329	N/A	INTRINSIC
low complexity region	1334	1355	N/A	INTRINSIC
low complexity region	1404	1418	N/A	INTRINSIC
Pfam:SPAR_C	1421	1666	2.5e-76	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000212168
AA Change: V708I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212987
AA Change: V708I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.1%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-induced proliferation-associated 1 like family. Members of this family contain a GTPase activating domain, a PDZ domain and a C-terminal coiled-coil domain with a leucine zipper. A similar protein in rat acts as a GTPases for the small GTPase Rap. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ano1	A	T	7: 144,618,863	S528T	probably benign	Het
Araf	G	T	X: 20,860,100	R601L	probably damaging	Homo
Bcl2l10	T	C	9: 75,351,072	I172T	possibly damaging	Het
Bpifb3	A	T	2: 153,929,323	N385I	possibly damaging	Het
Bsnd	A	G	4: 106,486,635	V158A	probably damaging	Het
Cacna1s	A	G	1: 136,089,045	N481S	probably benign	Het
Cdk5rap1	A	G	2: 154,368,241	V138A	probably damaging	Het
Cep290	A	G	10: 100,530,207	E1099G	probably damaging	Het
Cers1	T	A	8: 70,331,077	L225Q	probably damaging	Het
Cfb	T	C	17: 34,862,093	Q7R	probably benign	Het
Clk4	A	G	11: 51,271,921	S98G	possibly damaging	Het
Clock	A	G	5: 76,237,153	S406P	probably benign	Het
Csmd3	T	C	15: 47,621,437	I3178V	probably benign	Het
Dock10	A	G	1: 80,538,823	S1397P	probably damaging	Het
Fer1l4	A	G	2: 156,029,268	L1421P	probably damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Greb1	G	T	12: 16,735,151	T91K	probably damaging	Het
Grid2ip	G	A	5: 143,380,429	S379N	probably damaging	Het
Gucy1b2	A	T	14: 62,415,939	C336S	probably damaging	Het
Hdac1	A	G	4: 129,519,109	C261R	probably damaging	Het
Hrasls5	C	T	19: 7,637,466	T231I	probably damaging	Het
Htt	T	C	5: 34,852,087	S1471P	possibly damaging	Het
Ice1	A	G	13: 70,594,839	V2134A	probably damaging	Het
Ikzf1	C	T	11: 11,768,961	Q310*	probably null	Het
Il3ra	G	A	14: 14,350,180	V112I	probably benign	Het
Kif21b	A	G	1: 136,149,418	I393V	possibly damaging	Het
Krt74	T	C	15: 101,763,437		noncoding transcript	Het
Krtap29-1	T	C	11: 99,978,983	N24S	probably null	Het
Mut	T	C	17: 40,956,245	V570A	probably benign	Het
Myh7	T	C	14: 54,979,486	D1138G	probably damaging	Het
Nktr	T	C	9: 121,731,565	I125T	probably damaging	Het
Nlrp2	A	T	7: 5,317,555	L861Q	probably damaging	Het
Notch3	C	A	17: 32,147,290	R990L	probably benign	Het
Nrap	T	C	19: 56,361,721	D655G	probably benign	Het
Olfr1329	A	T	4: 118,917,230	V79E	probably benign	Het
Olfr1451	G	A	19: 12,999,870	V295I	probably damaging	Het
Osbpl11	T	A	16: 33,227,056	I463N	probably damaging	Het
Pcsk6	A	T	7: 66,033,844	R749W	probably damaging	Het
Plxnb1	T	C	9: 109,112,141		probably null	Het
Polr1a	T	A	6: 71,954,890		probably null	Het
Ppm1g	T	C	5: 31,206,406	I153V	probably damaging	Het
Ppp1r12a	T	C	10: 108,260,890	S191P	probably benign	Het
Prodh	T	C	16: 18,081,058	K178E	possibly damaging	Het
Rilpl2	A	G	5: 124,469,848	V103A	possibly damaging	Het
Sap18b	C	T	8: 95,825,541	H60Y	probably benign	Het
Sclt1	A	G	3: 41,629,516		probably null	Het
Serpinb1a	G	T	13: 32,842,866	H364Q	probably damaging	Het
Sez6l	G	A	5: 112,475,365	Q107*	probably null	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Uaca	T	A	9: 60,850,291		probably null	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Usp9y	C	T	Y: 1,316,735	R1938H	probably damaging	Homo
Wnk4	C	T	11: 101,265,431	R42W	probably damaging	Het
Zfp326	T	A	5: 105,905,980	L242Q	probably damaging	Het

Other mutations in Sipa1l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00534:Sipa1l2	APN	8	125491806	missense	probably damaging	1.00
IGL00939:Sipa1l2	APN	8	125464435	splice site	probably benign
IGL00965:Sipa1l2	APN	8	125447874	missense	probably benign	0.02
IGL01321:Sipa1l2	APN	8	125491518	missense	probably damaging	1.00
IGL01450:Sipa1l2	APN	8	125422577	critical splice donor site	probably null
IGL01753:Sipa1l2	APN	8	125453292	splice site	probably benign
IGL01930:Sipa1l2	APN	8	125419239	missense	probably damaging	0.99
IGL02041:Sipa1l2	APN	8	125491819	missense	probably benign	0.03
IGL02215:Sipa1l2	APN	8	125447837	missense	possibly damaging	0.67
IGL02272:Sipa1l2	APN	8	125492011	missense	probably damaging	1.00
IGL02370:Sipa1l2	APN	8	125480269	missense	probably damaging	1.00
IGL02538:Sipa1l2	APN	8	125451977	missense	probably damaging	1.00
IGL02633:Sipa1l2	APN	8	125447768	missense	probably damaging	1.00
IGL03394:Sipa1l2	APN	8	125491659	missense	possibly damaging	0.67
Rebellious	UTSW	8	125468339	missense	probably benign	0.01
R0144:Sipa1l2	UTSW	8	125449876	splice site	probably null
R0153:Sipa1l2	UTSW	8	125421898	missense	probably damaging	0.99
R0276:Sipa1l2	UTSW	8	125421940	missense	probably damaging	1.00
R0318:Sipa1l2	UTSW	8	125447697	missense	possibly damaging	0.73
R0373:Sipa1l2	UTSW	8	125464410	missense	probably damaging	0.99
R0427:Sipa1l2	UTSW	8	125480332	missense	probably damaging	1.00
R0634:Sipa1l2	UTSW	8	125422624	nonsense	probably null
R1377:Sipa1l2	UTSW	8	125491977	missense	probably damaging	1.00
R1404:Sipa1l2	UTSW	8	125449973	missense	probably damaging	1.00
R1404:Sipa1l2	UTSW	8	125449973	missense	probably damaging	1.00
R1435:Sipa1l2	UTSW	8	125468725	missense	probably damaging	1.00
R1523:Sipa1l2	UTSW	8	125447613	missense	possibly damaging	0.75
R1577:Sipa1l2	UTSW	8	125492262	missense	probably benign	0.00
R1581:Sipa1l2	UTSW	8	125491617	missense	probably damaging	0.96
R1583:Sipa1l2	UTSW	8	125421895	missense	probably damaging	0.97
R1719:Sipa1l2	UTSW	8	125444535	missense	probably damaging	0.99
R1730:Sipa1l2	UTSW	8	125480141	splice site	probably null
R1940:Sipa1l2	UTSW	8	125480148	splice site	probably benign
R2007:Sipa1l2	UTSW	8	125439437	missense	probably damaging	1.00
R2141:Sipa1l2	UTSW	8	125491491	missense	probably benign	0.07
R2203:Sipa1l2	UTSW	8	125491627	missense	probably damaging	0.99
R2764:Sipa1l2	UTSW	8	125492374	missense	probably damaging	0.99
R3722:Sipa1l2	UTSW	8	125473584	missense	probably damaging	1.00
R3787:Sipa1l2	UTSW	8	125423205	missense	probably benign
R3787:Sipa1l2	UTSW	8	125450383	missense	possibly damaging	0.52
R4106:Sipa1l2	UTSW	8	125492308	missense	probably damaging	1.00
R4117:Sipa1l2	UTSW	8	125468510	missense	probably damaging	1.00
R4194:Sipa1l2	UTSW	8	125491672	missense	probably benign	0.00
R4237:Sipa1l2	UTSW	8	125491656	missense	probably benign	0.44
R4240:Sipa1l2	UTSW	8	125491656	missense	probably benign	0.44
R4448:Sipa1l2	UTSW	8	125492355	missense	probably damaging	1.00
R4515:Sipa1l2	UTSW	8	125492226	missense	probably benign	0.00
R4519:Sipa1l2	UTSW	8	125492226	missense	probably benign	0.00
R4523:Sipa1l2	UTSW	8	125492424	missense	probably damaging	1.00
R4557:Sipa1l2	UTSW	8	125464415	missense	probably damaging	0.98
R4667:Sipa1l2	UTSW	8	125453470	missense	possibly damaging	0.93
R4687:Sipa1l2	UTSW	8	125491245	missense	probably damaging	1.00
R4854:Sipa1l2	UTSW	8	125473601	missense	probably damaging	1.00
R4890:Sipa1l2	UTSW	8	125491867	missense	probably damaging	1.00
R5065:Sipa1l2	UTSW	8	125491585	missense	probably benign	0.19
R5194:Sipa1l2	UTSW	8	125439273	missense	possibly damaging	0.48
R5266:Sipa1l2	UTSW	8	125492126	missense	probably damaging	0.99
R5475:Sipa1l2	UTSW	8	125491595	missense	probably damaging	1.00
R5718:Sipa1l2	UTSW	8	125491248	missense	probably damaging	1.00
R5910:Sipa1l2	UTSW	8	125491684	missense	probably benign	0.42
R5916:Sipa1l2	UTSW	8	125468573	missense	probably damaging	1.00
R5941:Sipa1l2	UTSW	8	125473536	missense	probably damaging	0.99
R6083:Sipa1l2	UTSW	8	125468473	missense	possibly damaging	0.87
R6185:Sipa1l2	UTSW	8	125468253	nonsense	probably null
R6235:Sipa1l2	UTSW	8	125474871	missense	probably damaging	1.00
R6299:Sipa1l2	UTSW	8	125453464	missense	possibly damaging	0.75
R6374:Sipa1l2	UTSW	8	125444630	missense	probably damaging	1.00
R6459:Sipa1l2	UTSW	8	125444484	critical splice donor site	probably null
R6462:Sipa1l2	UTSW	8	125491230	missense	probably damaging	1.00
R6496:Sipa1l2	UTSW	8	125449894	missense	probably benign	0.00
R6543:Sipa1l2	UTSW	8	125450362	missense	possibly damaging	0.50
R7154:Sipa1l2	UTSW	8	125468339	missense	probably benign	0.01
R7192:Sipa1l2	UTSW	8	125422609	missense	probably benign	0.09
R7240:Sipa1l2	UTSW	8	125469860	missense	probably damaging	1.00
R7361:Sipa1l2	UTSW	8	125453332	missense	probably damaging	1.00
R7383:Sipa1l2	UTSW	8	125447646	missense	probably damaging	1.00
R7417:Sipa1l2	UTSW	8	125482106	missense	possibly damaging	0.93
R7604:Sipa1l2	UTSW	8	125419272	missense	probably benign	0.45
R7658:Sipa1l2	UTSW	8	125492290	missense	probably benign	0.00
R7743:Sipa1l2	UTSW	8	125464233	missense	probably damaging	1.00
R7781:Sipa1l2	UTSW	8	125491827	missense	possibly damaging	0.46
R7812:Sipa1l2	UTSW	8	125491595	missense	probably damaging	1.00
R7829:Sipa1l2	UTSW	8	125451988	missense	probably damaging	1.00
R7880:Sipa1l2	UTSW	8	125464393	missense	probably damaging	1.00
R7884:Sipa1l2	UTSW	8	125447598	missense	probably benign
R8057:Sipa1l2	UTSW	8	125468530	missense	probably damaging	1.00
R8082:Sipa1l2	UTSW	8	125491809	missense	possibly damaging	0.82
R8092:Sipa1l2	UTSW	8	125419168	missense	probably benign	0.03
R8247:Sipa1l2	UTSW	8	125422633	missense	probably benign	0.29
R8252:Sipa1l2	UTSW	8	125468671	missense	probably damaging	1.00
R8386:Sipa1l2	UTSW	8	125492093	missense	probably damaging	1.00
R8466:Sipa1l2	UTSW	8	125492246	missense	probably damaging	1.00
R8697:Sipa1l2	UTSW	8	125482116	missense	probably damaging	1.00
R8725:Sipa1l2	UTSW	8	125450386	missense	probably benign	0.28
R8727:Sipa1l2	UTSW	8	125450386	missense	probably benign	0.28
R9048:Sipa1l2	UTSW	8	125447726	missense	possibly damaging	0.59
R9224:Sipa1l2	UTSW	8	125491977	missense	probably damaging	1.00
R9279:Sipa1l2	UTSW	8	125482157	missense	probably damaging	1.00
R9392:Sipa1l2	UTSW	8	125468221	missense	probably benign
R9574:Sipa1l2	UTSW	8	125442714	missense	probably benign
R9591:Sipa1l2	UTSW	8	125492373	missense	probably damaging	0.99
R9614:Sipa1l2	UTSW	8	125469826	missense	probably null	0.01
R9690:Sipa1l2	UTSW	8	125492257	missense	probably benign
X0027:Sipa1l2	UTSW	8	125492136	missense	probably damaging	1.00
Z1177:Sipa1l2	UTSW	8	125447556	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- AGCCTAGACTATACAGTGGGG -3'
(R):5'- AAGGGCTCTGCTTGTCTCTG -3'

Sequencing Primer
(F):5'- CCTAGACTATACAGTGGGGGAGGG -3'
(R):5'- TGTTCCTTTCTCGGCTGAG -3'

Posted On

2018-03-15