Mutagenetix > Incidental Mutation

Incidental Mutation 'R6274:Cep290'

507535

Institutional Source

Beutler Lab

Gene Symbol

Cep290

Ensembl Gene

ENSMUSG00000019971

Gene Name

centrosomal protein 290

Synonyms

b2b1454Clo, Nphp6, b2b1752Clo

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.941) question?

Stock #

R6274 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100487558-100574840 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100530207 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1099 (E1099G)

Ref Sequence

ENSEMBL: ENSMUSP00000151388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164751] [ENSMUST00000219765] [ENSMUST00000220346]

AlphaFold

Q6A078

Predicted Effect

probably damaging
Transcript: ENSMUST00000164751
AA Change: E1099G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971
AA Change: E1099G

Domain	Start	End	E-Value	Type
coiled coil region	59	298	N/A	INTRINSIC
coiled coil region	319	566	N/A	INTRINSIC
coiled coil region	598	662	N/A	INTRINSIC
coiled coil region	697	754	N/A	INTRINSIC
coiled coil region	780	875	N/A	INTRINSIC
internal_repeat_2	884	894	1.1e-5	PROSPERO
coiled coil region	986	1028	N/A	INTRINSIC
internal_repeat_2	1057	1067	1.1e-5	PROSPERO
coiled coil region	1071	1109	N/A	INTRINSIC
low complexity region	1140	1156	N/A	INTRINSIC
internal_repeat_1	1176	1206	8.72e-8	PROSPERO
coiled coil region	1221	1250	N/A	INTRINSIC
Pfam:CEP209_CC5	1290	1417	3.8e-55	PFAM
low complexity region	1476	1493	N/A	INTRINSIC
internal_repeat_1	1498	1525	8.72e-8	PROSPERO
coiled coil region	1535	1595	N/A	INTRINSIC
coiled coil region	1624	1716	N/A	INTRINSIC
coiled coil region	1776	2328	N/A	INTRINSIC
low complexity region	2333	2347	N/A	INTRINSIC
coiled coil region	2377	2453	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000219765
AA Change: E1092G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000220346
AA Change: E1099G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.2542

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.1%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ano1	A	T	7: 144,618,863	S528T	probably benign	Het
Araf	G	T	X: 20,860,100	R601L	probably damaging	Homo
Bcl2l10	T	C	9: 75,351,072	I172T	possibly damaging	Het
Bpifb3	A	T	2: 153,929,323	N385I	possibly damaging	Het
Bsnd	A	G	4: 106,486,635	V158A	probably damaging	Het
Cacna1s	A	G	1: 136,089,045	N481S	probably benign	Het
Cdk5rap1	A	G	2: 154,368,241	V138A	probably damaging	Het
Cers1	T	A	8: 70,331,077	L225Q	probably damaging	Het
Cfb	T	C	17: 34,862,093	Q7R	probably benign	Het
Clk4	A	G	11: 51,271,921	S98G	possibly damaging	Het
Clock	A	G	5: 76,237,153	S406P	probably benign	Het
Csmd3	T	C	15: 47,621,437	I3178V	probably benign	Het
Dock10	A	G	1: 80,538,823	S1397P	probably damaging	Het
Fer1l4	A	G	2: 156,029,268	L1421P	probably damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Greb1	G	T	12: 16,735,151	T91K	probably damaging	Het
Grid2ip	G	A	5: 143,380,429	S379N	probably damaging	Het
Gucy1b2	A	T	14: 62,415,939	C336S	probably damaging	Het
Hdac1	A	G	4: 129,519,109	C261R	probably damaging	Het
Hrasls5	C	T	19: 7,637,466	T231I	probably damaging	Het
Htt	T	C	5: 34,852,087	S1471P	possibly damaging	Het
Ice1	A	G	13: 70,594,839	V2134A	probably damaging	Het
Ikzf1	C	T	11: 11,768,961	Q310*	probably null	Het
Il3ra	G	A	14: 14,350,180	V112I	probably benign	Het
Kif21b	A	G	1: 136,149,418	I393V	possibly damaging	Het
Krt74	T	C	15: 101,763,437		noncoding transcript	Het
Krtap29-1	T	C	11: 99,978,983	N24S	probably null	Het
Mut	T	C	17: 40,956,245	V570A	probably benign	Het
Myh7	T	C	14: 54,979,486	D1138G	probably damaging	Het
Nktr	T	C	9: 121,731,565	I125T	probably damaging	Het
Nlrp2	A	T	7: 5,317,555	L861Q	probably damaging	Het
Notch3	C	A	17: 32,147,290	R990L	probably benign	Het
Nrap	T	C	19: 56,361,721	D655G	probably benign	Het
Olfr1329	A	T	4: 118,917,230	V79E	probably benign	Het
Olfr1451	G	A	19: 12,999,870	V295I	probably damaging	Het
Osbpl11	T	A	16: 33,227,056	I463N	probably damaging	Het
Pcsk6	A	T	7: 66,033,844	R749W	probably damaging	Het
Plxnb1	T	C	9: 109,112,141		probably null	Het
Polr1a	T	A	6: 71,954,890		probably null	Het
Ppm1g	T	C	5: 31,206,406	I153V	probably damaging	Het
Ppp1r12a	T	C	10: 108,260,890	S191P	probably benign	Het
Prodh	T	C	16: 18,081,058	K178E	possibly damaging	Het
Rilpl2	A	G	5: 124,469,848	V103A	possibly damaging	Het
Sap18b	C	T	8: 95,825,541	H60Y	probably benign	Het
Sclt1	A	G	3: 41,629,516		probably null	Het
Serpinb1a	G	T	13: 32,842,866	H364Q	probably damaging	Het
Sez6l	G	A	5: 112,475,365	Q107*	probably null	Het
Sipa1l2	C	T	8: 125,469,872	V708I	probably damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Uaca	T	A	9: 60,850,291		probably null	Het
Uqcrc1	C	A	9: 108,942,156	H95N	probably damaging	Het
Usp9y	C	T	Y: 1,316,735	R1938H	probably damaging	Homo
Wnk4	C	T	11: 101,265,431	R42W	probably damaging	Het
Zfp326	T	A	5: 105,905,980	L242Q	probably damaging	Het

Other mutations in Cep290

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Cep290	APN	10	100508724	missense	probably benign	0.00
IGL00499:Cep290	APN	10	100543327	missense	probably damaging	1.00
IGL00547:Cep290	APN	10	100510708	missense	probably damaging	0.99
IGL00573:Cep290	APN	10	100540361	missense	probably damaging	1.00
IGL00646:Cep290	APN	10	100501154	missense	probably benign	0.15
IGL00755:Cep290	APN	10	100531104	missense	probably damaging	1.00
IGL00835:Cep290	APN	10	100563380	nonsense	probably null
IGL00846:Cep290	APN	10	100540333	splice site	probably benign
IGL00985:Cep290	APN	10	100567161	splice site	probably benign
IGL01687:Cep290	APN	10	100500205	missense	probably damaging	1.00
IGL01782:Cep290	APN	10	100545125	nonsense	probably null
IGL02010:Cep290	APN	10	100508707	missense	probably benign	0.39
IGL02010:Cep290	APN	10	100561345	missense	probably benign	0.00
IGL02036:Cep290	APN	10	100558100	nonsense	probably null
IGL02039:Cep290	APN	10	100514602	critical splice donor site	probably null
IGL02532:Cep290	APN	10	100545065	missense	probably benign	0.04
IGL02950:Cep290	APN	10	100540329	splice site	probably benign
IGL03105:Cep290	APN	10	100551824	missense	possibly damaging	0.66
IGL03179:Cep290	APN	10	100568088	missense	possibly damaging	0.60
IGL03271:Cep290	APN	10	100537801	missense	probably benign	0.09
IGL03401:Cep290	APN	10	100500265	missense	probably benign	0.27
PIT4687001:Cep290	UTSW	10	100537591	missense	probably benign	0.28
R0025:Cep290	UTSW	10	100537831	missense	probably damaging	1.00
R0127:Cep290	UTSW	10	100536925	splice site	probably benign
R0254:Cep290	UTSW	10	100514574	missense	probably benign	0.31
R0295:Cep290	UTSW	10	100537821	missense	probably damaging	0.99
R0371:Cep290	UTSW	10	100518564	splice site	probably benign
R0390:Cep290	UTSW	10	100508758	missense	probably benign	0.09
R0399:Cep290	UTSW	10	100554400	splice site	probably benign
R0413:Cep290	UTSW	10	100523314	nonsense	probably null
R0427:Cep290	UTSW	10	100516179	missense	probably benign	0.01
R0472:Cep290	UTSW	10	100551455	missense	probably benign	0.19
R0485:Cep290	UTSW	10	100549344	missense	possibly damaging	0.94
R0635:Cep290	UTSW	10	100492676	missense	probably damaging	1.00
R0675:Cep290	UTSW	10	100568813	critical splice acceptor site	probably null
R0972:Cep290	UTSW	10	100518762	missense	probably benign	0.08
R1238:Cep290	UTSW	10	100517863	missense	probably damaging	1.00
R1297:Cep290	UTSW	10	100539100	splice site	probably benign
R1368:Cep290	UTSW	10	100494966	splice site	probably benign
R1394:Cep290	UTSW	10	100537529	missense	possibly damaging	0.66
R1437:Cep290	UTSW	10	100572101	missense	probably benign	0.00
R1493:Cep290	UTSW	10	100562181	missense	probably benign	0.21
R1496:Cep290	UTSW	10	100538966	missense	probably damaging	1.00
R1539:Cep290	UTSW	10	100496828	missense	probably benign	0.06
R1598:Cep290	UTSW	10	100549329	missense	probably damaging	1.00
R1616:Cep290	UTSW	10	100568836	missense	probably benign
R1712:Cep290	UTSW	10	100554499	missense	probably benign	0.02
R1753:Cep290	UTSW	10	100513981	missense	probably benign
R1773:Cep290	UTSW	10	100510573	missense	probably benign
R1775:Cep290	UTSW	10	100496810	missense	probably damaging	0.98
R1799:Cep290	UTSW	10	100516196	missense	probably benign	0.00
R1937:Cep290	UTSW	10	100497953	missense	possibly damaging	0.71
R1991:Cep290	UTSW	10	100531184	missense	possibly damaging	0.80
R2031:Cep290	UTSW	10	100512400	critical splice donor site	probably null
R2164:Cep290	UTSW	10	100518795	missense	probably damaging	0.96
R2393:Cep290	UTSW	10	100561238	critical splice acceptor site	probably null
R2403:Cep290	UTSW	10	100537437	missense	probably benign	0.19
R3612:Cep290	UTSW	10	100541581	nonsense	probably null
R3800:Cep290	UTSW	10	100572941	missense	probably damaging	0.97
R4005:Cep290	UTSW	10	100539008	missense	probably damaging	1.00
R4039:Cep290	UTSW	10	100512401	critical splice donor site	probably null
R4259:Cep290	UTSW	10	100514492	missense	probably damaging	1.00
R4260:Cep290	UTSW	10	100514492	missense	probably damaging	1.00
R4319:Cep290	UTSW	10	100539047	missense	probably benign	0.09
R4329:Cep290	UTSW	10	100537668	missense	probably damaging	0.98
R4573:Cep290	UTSW	10	100518850	missense	probably benign
R4614:Cep290	UTSW	10	100508740	missense	probably benign
R4614:Cep290	UTSW	10	100559687	missense	possibly damaging	0.93
R4708:Cep290	UTSW	10	100523264	missense	probably benign	0.02
R4727:Cep290	UTSW	10	100563270	missense	probably benign	0.05
R4825:Cep290	UTSW	10	100488348	missense	probably damaging	0.96
R4839:Cep290	UTSW	10	100508786	missense	probably damaging	0.99
R4858:Cep290	UTSW	10	100494911	missense	probably benign	0.31
R4871:Cep290	UTSW	10	100548914	missense	probably benign	0.22
R5094:Cep290	UTSW	10	100567030	missense	probably damaging	0.97
R5103:Cep290	UTSW	10	100539020	missense	probably damaging	1.00
R5499:Cep290	UTSW	10	100537653	missense	probably damaging	0.99
R5505:Cep290	UTSW	10	100499186	critical splice donor site	probably null
R5615:Cep290	UTSW	10	100531150	missense	probably damaging	1.00
R5815:Cep290	UTSW	10	100558108	missense	possibly damaging	0.80
R5883:Cep290	UTSW	10	100523399	missense	probably benign	0.44
R5889:Cep290	UTSW	10	100499074	missense	possibly damaging	0.95
R5928:Cep290	UTSW	10	100551830	missense	probably damaging	0.99
R5992:Cep290	UTSW	10	100543321	missense	possibly damaging	0.73
R6000:Cep290	UTSW	10	100541787	missense	probably damaging	1.00
R6213:Cep290	UTSW	10	100523360	missense	probably benign	0.06
R6285:Cep290	UTSW	10	100523329	missense	probably benign	0.17
R6306:Cep290	UTSW	10	100531166	missense	possibly damaging	0.89
R6593:Cep290	UTSW	10	100508776	missense	probably benign	0.01
R6649:Cep290	UTSW	10	100518531	missense	probably benign	0.28
R6692:Cep290	UTSW	10	100569144	splice site	probably null
R6788:Cep290	UTSW	10	100488628	missense	probably damaging	1.00
R6847:Cep290	UTSW	10	100563419	missense	probably damaging	1.00
R6947:Cep290	UTSW	10	100530056	missense	probably damaging	1.00
R7035:Cep290	UTSW	10	100499071	missense	probably benign	0.07
R7073:Cep290	UTSW	10	100539003	missense	possibly damaging	0.90
R7114:Cep290	UTSW	10	100543358	missense	probably damaging	0.98
R7256:Cep290	UTSW	10	100546498	missense	probably damaging	1.00
R7258:Cep290	UTSW	10	100499108	missense	probably benign	0.01
R7311:Cep290	UTSW	10	100537718	missense	probably damaging	0.98
R7505:Cep290	UTSW	10	100516265	missense	probably benign	0.01
R7615:Cep290	UTSW	10	100492681	missense	probably benign	0.03
R7643:Cep290	UTSW	10	100537553	missense	probably benign
R7662:Cep290	UTSW	10	100537803	missense	probably benign	0.21
R7663:Cep290	UTSW	10	100554536	critical splice donor site	probably null
R7685:Cep290	UTSW	10	100540057	missense	probably benign	0.19
R7699:Cep290	UTSW	10	100540369	missense	probably benign	0.33
R7717:Cep290	UTSW	10	100492681	missense	probably benign	0.03
R7747:Cep290	UTSW	10	100558176	nonsense	probably null
R7757:Cep290	UTSW	10	100563434	missense	probably benign
R7843:Cep290	UTSW	10	100516188	missense	possibly damaging	0.49
R7905:Cep290	UTSW	10	100554490	missense	probably benign
R8078:Cep290	UTSW	10	100572887	missense	probably benign	0.04
R8081:Cep290	UTSW	10	100558176	nonsense	probably null
R8094:Cep290	UTSW	10	100544931	missense	possibly damaging	0.95
R8266:Cep290	UTSW	10	100559671	missense	probably benign	0.08
R8305:Cep290	UTSW	10	100544934	missense	probably benign	0.09
R8325:Cep290	UTSW	10	100517808	missense	probably benign	0.03
R8372:Cep290	UTSW	10	100549341	missense	probably benign	0.00
R8443:Cep290	UTSW	10	100495844	missense	possibly damaging	0.80
R8497:Cep290	UTSW	10	100551458	missense	probably damaging	1.00
R8778:Cep290	UTSW	10	100514512	nonsense	probably null
R8975:Cep290	UTSW	10	100513920	missense	possibly damaging	0.54
R9146:Cep290	UTSW	10	100541803	missense	probably benign	0.44
R9264:Cep290	UTSW	10	100498016	missense	possibly damaging	0.86
R9374:Cep290	UTSW	10	100536867	missense	probably damaging	0.98
R9448:Cep290	UTSW	10	100559684	missense	probably benign	0.32
R9499:Cep290	UTSW	10	100536867	missense	probably damaging	0.98
R9507:Cep290	UTSW	10	100494923	missense	possibly damaging	0.81
R9539:Cep290	UTSW	10	100568851	missense	probably damaging	1.00
R9547:Cep290	UTSW	10	100544979	missense	probably benign	0.00
R9551:Cep290	UTSW	10	100536867	missense	probably damaging	0.98
R9657:Cep290	UTSW	10	100515141	missense	possibly damaging	0.93
R9731:Cep290	UTSW	10	100510542	missense	probably damaging	0.98
R9756:Cep290	UTSW	10	100516172	missense	probably damaging	0.97
R9777:Cep290	UTSW	10	100518667	missense	probably benign	0.01
Z1176:Cep290	UTSW	10	100549374	critical splice donor site	probably benign
Z1177:Cep290	UTSW	10	100497944	missense	probably benign
Z1177:Cep290	UTSW	10	100538997	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GTTGCACATAGGAAATGACTCAAAC -3'
(R):5'- AGAATCTGTCTACGGAAACAAGTGC -3'

Sequencing Primer
(F):5'- TGACTCAAACATGGATAAGGCTAAG -3'
(R):5'- GTCTACGGAAACAAGTGCTTTGATG -3'

Posted On

2018-03-15