Incidental Mutation 'R6274:Cep290'
ID 507535
Institutional Source Beutler Lab
Gene Symbol Cep290
Ensembl Gene ENSMUSG00000019971
Gene Name centrosomal protein 290
Synonyms Kiaa, Nphp6, b2b1752Clo, b2b1454Clo
MMRRC Submission 044444-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.951) question?
Stock # R6274 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 100323410-100409527 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 100366069 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1099 (E1099G)
Ref Sequence ENSEMBL: ENSMUSP00000151388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164751] [ENSMUST00000219765] [ENSMUST00000220346]
AlphaFold Q6A078
Predicted Effect probably damaging
Transcript: ENSMUST00000164751
AA Change: E1099G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971
AA Change: E1099G

DomainStartEndE-ValueType
coiled coil region 59 298 N/A INTRINSIC
coiled coil region 319 566 N/A INTRINSIC
coiled coil region 598 662 N/A INTRINSIC
coiled coil region 697 754 N/A INTRINSIC
coiled coil region 780 875 N/A INTRINSIC
internal_repeat_2 884 894 1.1e-5 PROSPERO
coiled coil region 986 1028 N/A INTRINSIC
internal_repeat_2 1057 1067 1.1e-5 PROSPERO
coiled coil region 1071 1109 N/A INTRINSIC
low complexity region 1140 1156 N/A INTRINSIC
internal_repeat_1 1176 1206 8.72e-8 PROSPERO
coiled coil region 1221 1250 N/A INTRINSIC
Pfam:CEP209_CC5 1290 1417 3.8e-55 PFAM
low complexity region 1476 1493 N/A INTRINSIC
internal_repeat_1 1498 1525 8.72e-8 PROSPERO
coiled coil region 1535 1595 N/A INTRINSIC
coiled coil region 1624 1716 N/A INTRINSIC
coiled coil region 1776 2328 N/A INTRINSIC
low complexity region 2333 2347 N/A INTRINSIC
coiled coil region 2377 2453 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219765
AA Change: E1092G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000220346
AA Change: E1099G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.2542 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Ano1 A T 7: 144,172,600 (GRCm39) S528T probably benign Het
Araf G T X: 20,726,339 (GRCm39) R601L probably damaging Homo
Bcl2l10 T C 9: 75,258,354 (GRCm39) I172T possibly damaging Het
Bpifb3 A T 2: 153,771,243 (GRCm39) N385I possibly damaging Het
Bsnd A G 4: 106,343,832 (GRCm39) V158A probably damaging Het
Cacna1s A G 1: 136,016,783 (GRCm39) N481S probably benign Het
Cdk5rap1 A G 2: 154,210,161 (GRCm39) V138A probably damaging Het
Cers1 T A 8: 70,783,727 (GRCm39) L225Q probably damaging Het
Cfb T C 17: 35,081,069 (GRCm39) Q7R probably benign Het
Clk4 A G 11: 51,162,748 (GRCm39) S98G possibly damaging Het
Clock A G 5: 76,385,000 (GRCm39) S406P probably benign Het
Csmd3 T C 15: 47,484,833 (GRCm39) I3178V probably benign Het
Dock10 A G 1: 80,516,540 (GRCm39) S1397P probably damaging Het
Fer1l4 A G 2: 155,871,188 (GRCm39) L1421P probably damaging Het
Fetub C T 16: 22,751,081 (GRCm39) R143C probably damaging Het
Greb1 G T 12: 16,785,152 (GRCm39) T91K probably damaging Het
Grid2ip G A 5: 143,366,184 (GRCm39) S379N probably damaging Het
Gucy1b2 A T 14: 62,653,388 (GRCm39) C336S probably damaging Het
Hdac1 A G 4: 129,412,902 (GRCm39) C261R probably damaging Het
Htt T C 5: 35,009,431 (GRCm39) S1471P possibly damaging Het
Ice1 A G 13: 70,742,958 (GRCm39) V2134A probably damaging Het
Ikzf1 C T 11: 11,718,961 (GRCm39) Q310* probably null Het
Il3ra G A 14: 14,350,180 (GRCm38) V112I probably benign Het
Kif21b A G 1: 136,077,156 (GRCm39) I393V possibly damaging Het
Krt74 T C 15: 101,671,872 (GRCm39) noncoding transcript Het
Krtap29-1 T C 11: 99,869,809 (GRCm39) N24S probably null Het
Mmut T C 17: 41,267,136 (GRCm39) V570A probably benign Het
Myh7 T C 14: 55,216,943 (GRCm39) D1138G probably damaging Het
Nktr T C 9: 121,560,631 (GRCm39) I125T probably damaging Het
Nlrp2 A T 7: 5,320,554 (GRCm39) L861Q probably damaging Het
Notch3 C A 17: 32,366,264 (GRCm39) R990L probably benign Het
Nrap T C 19: 56,350,153 (GRCm39) D655G probably benign Het
Or10ak8 A T 4: 118,774,427 (GRCm39) V79E probably benign Het
Or5b99 G A 19: 12,977,234 (GRCm39) V295I probably damaging Het
Osbpl11 T A 16: 33,047,426 (GRCm39) I463N probably damaging Het
Pcsk6 A T 7: 65,683,592 (GRCm39) R749W probably damaging Het
Plaat5 C T 19: 7,614,831 (GRCm39) T231I probably damaging Het
Plxnb1 T C 9: 108,941,209 (GRCm39) probably null Het
Polr1a T A 6: 71,931,874 (GRCm39) probably null Het
Ppm1g T C 5: 31,363,750 (GRCm39) I153V probably damaging Het
Ppp1r12a T C 10: 108,096,751 (GRCm39) S191P probably benign Het
Prodh T C 16: 17,898,922 (GRCm39) K178E possibly damaging Het
Rilpl2 A G 5: 124,607,911 (GRCm39) V103A possibly damaging Het
Sap18b C T 8: 96,552,169 (GRCm39) H60Y probably benign Het
Sclt1 A G 3: 41,583,951 (GRCm39) probably null Het
Serpinb1a G T 13: 33,026,849 (GRCm39) H364Q probably damaging Het
Sez6l G A 5: 112,623,231 (GRCm39) Q107* probably null Het
Sipa1l2 C T 8: 126,196,611 (GRCm39) V708I probably damaging Het
Tbc1d2 C T 4: 46,629,912 (GRCm39) G252R probably benign Het
Uaca T A 9: 60,757,573 (GRCm39) probably null Het
Uqcrc1 C A 9: 108,771,224 (GRCm39) H95N probably damaging Het
Usp9y C T Y: 1,316,735 (GRCm39) R1938H probably damaging Homo
Wnk4 C T 11: 101,156,257 (GRCm39) R42W probably damaging Het
Zfp326 T A 5: 106,053,846 (GRCm39) L242Q probably damaging Het
Other mutations in Cep290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Cep290 APN 10 100,344,586 (GRCm39) missense probably benign 0.00
IGL00499:Cep290 APN 10 100,379,189 (GRCm39) missense probably damaging 1.00
IGL00547:Cep290 APN 10 100,346,570 (GRCm39) missense probably damaging 0.99
IGL00573:Cep290 APN 10 100,376,223 (GRCm39) missense probably damaging 1.00
IGL00646:Cep290 APN 10 100,337,016 (GRCm39) missense probably benign 0.15
IGL00755:Cep290 APN 10 100,366,966 (GRCm39) missense probably damaging 1.00
IGL00835:Cep290 APN 10 100,399,242 (GRCm39) nonsense probably null
IGL00846:Cep290 APN 10 100,376,195 (GRCm39) splice site probably benign
IGL00985:Cep290 APN 10 100,403,023 (GRCm39) splice site probably benign
IGL01687:Cep290 APN 10 100,336,067 (GRCm39) missense probably damaging 1.00
IGL01782:Cep290 APN 10 100,380,987 (GRCm39) nonsense probably null
IGL02010:Cep290 APN 10 100,397,207 (GRCm39) missense probably benign 0.00
IGL02010:Cep290 APN 10 100,344,569 (GRCm39) missense probably benign 0.39
IGL02036:Cep290 APN 10 100,393,962 (GRCm39) nonsense probably null
IGL02039:Cep290 APN 10 100,350,464 (GRCm39) critical splice donor site probably null
IGL02532:Cep290 APN 10 100,380,927 (GRCm39) missense probably benign 0.04
IGL02950:Cep290 APN 10 100,376,191 (GRCm39) splice site probably benign
IGL03105:Cep290 APN 10 100,387,686 (GRCm39) missense possibly damaging 0.66
IGL03179:Cep290 APN 10 100,403,950 (GRCm39) missense possibly damaging 0.60
IGL03271:Cep290 APN 10 100,373,663 (GRCm39) missense probably benign 0.09
IGL03401:Cep290 APN 10 100,336,127 (GRCm39) missense probably benign 0.27
PIT4687001:Cep290 UTSW 10 100,373,453 (GRCm39) missense probably benign 0.28
R0025:Cep290 UTSW 10 100,373,693 (GRCm39) missense probably damaging 1.00
R0127:Cep290 UTSW 10 100,372,787 (GRCm39) splice site probably benign
R0254:Cep290 UTSW 10 100,350,436 (GRCm39) missense probably benign 0.31
R0295:Cep290 UTSW 10 100,373,683 (GRCm39) missense probably damaging 0.99
R0371:Cep290 UTSW 10 100,354,426 (GRCm39) splice site probably benign
R0390:Cep290 UTSW 10 100,344,620 (GRCm39) missense probably benign 0.09
R0399:Cep290 UTSW 10 100,390,262 (GRCm39) splice site probably benign
R0413:Cep290 UTSW 10 100,359,176 (GRCm39) nonsense probably null
R0427:Cep290 UTSW 10 100,352,041 (GRCm39) missense probably benign 0.01
R0472:Cep290 UTSW 10 100,387,317 (GRCm39) missense probably benign 0.19
R0485:Cep290 UTSW 10 100,385,206 (GRCm39) missense possibly damaging 0.94
R0635:Cep290 UTSW 10 100,328,538 (GRCm39) missense probably damaging 1.00
R0675:Cep290 UTSW 10 100,404,675 (GRCm39) critical splice acceptor site probably null
R0972:Cep290 UTSW 10 100,354,624 (GRCm39) missense probably benign 0.08
R1238:Cep290 UTSW 10 100,353,725 (GRCm39) missense probably damaging 1.00
R1297:Cep290 UTSW 10 100,374,962 (GRCm39) splice site probably benign
R1368:Cep290 UTSW 10 100,330,828 (GRCm39) splice site probably benign
R1394:Cep290 UTSW 10 100,373,391 (GRCm39) missense possibly damaging 0.66
R1437:Cep290 UTSW 10 100,407,963 (GRCm39) missense probably benign 0.00
R1493:Cep290 UTSW 10 100,398,043 (GRCm39) missense probably benign 0.21
R1496:Cep290 UTSW 10 100,374,828 (GRCm39) missense probably damaging 1.00
R1539:Cep290 UTSW 10 100,332,690 (GRCm39) missense probably benign 0.06
R1598:Cep290 UTSW 10 100,385,191 (GRCm39) missense probably damaging 1.00
R1616:Cep290 UTSW 10 100,404,698 (GRCm39) missense probably benign
R1712:Cep290 UTSW 10 100,390,361 (GRCm39) missense probably benign 0.02
R1753:Cep290 UTSW 10 100,349,843 (GRCm39) missense probably benign
R1773:Cep290 UTSW 10 100,346,435 (GRCm39) missense probably benign
R1775:Cep290 UTSW 10 100,332,672 (GRCm39) missense probably damaging 0.98
R1799:Cep290 UTSW 10 100,352,058 (GRCm39) missense probably benign 0.00
R1937:Cep290 UTSW 10 100,333,815 (GRCm39) missense possibly damaging 0.71
R1991:Cep290 UTSW 10 100,367,046 (GRCm39) missense possibly damaging 0.80
R2031:Cep290 UTSW 10 100,348,262 (GRCm39) critical splice donor site probably null
R2164:Cep290 UTSW 10 100,354,657 (GRCm39) missense probably damaging 0.96
R2393:Cep290 UTSW 10 100,397,100 (GRCm39) critical splice acceptor site probably null
R2403:Cep290 UTSW 10 100,373,299 (GRCm39) missense probably benign 0.19
R3612:Cep290 UTSW 10 100,377,443 (GRCm39) nonsense probably null
R3800:Cep290 UTSW 10 100,408,803 (GRCm39) missense probably damaging 0.97
R4005:Cep290 UTSW 10 100,374,870 (GRCm39) missense probably damaging 1.00
R4039:Cep290 UTSW 10 100,348,263 (GRCm39) critical splice donor site probably null
R4259:Cep290 UTSW 10 100,350,354 (GRCm39) missense probably damaging 1.00
R4260:Cep290 UTSW 10 100,350,354 (GRCm39) missense probably damaging 1.00
R4319:Cep290 UTSW 10 100,374,909 (GRCm39) missense probably benign 0.09
R4329:Cep290 UTSW 10 100,373,530 (GRCm39) missense probably damaging 0.98
R4573:Cep290 UTSW 10 100,354,712 (GRCm39) missense probably benign
R4614:Cep290 UTSW 10 100,395,549 (GRCm39) missense possibly damaging 0.93
R4614:Cep290 UTSW 10 100,344,602 (GRCm39) missense probably benign
R4708:Cep290 UTSW 10 100,359,126 (GRCm39) missense probably benign 0.02
R4727:Cep290 UTSW 10 100,399,132 (GRCm39) missense probably benign 0.05
R4825:Cep290 UTSW 10 100,324,210 (GRCm39) missense probably damaging 0.96
R4839:Cep290 UTSW 10 100,344,648 (GRCm39) missense probably damaging 0.99
R4858:Cep290 UTSW 10 100,330,773 (GRCm39) missense probably benign 0.31
R4871:Cep290 UTSW 10 100,384,776 (GRCm39) missense probably benign 0.22
R5094:Cep290 UTSW 10 100,402,892 (GRCm39) missense probably damaging 0.97
R5103:Cep290 UTSW 10 100,374,882 (GRCm39) missense probably damaging 1.00
R5499:Cep290 UTSW 10 100,373,515 (GRCm39) missense probably damaging 0.99
R5505:Cep290 UTSW 10 100,335,048 (GRCm39) critical splice donor site probably null
R5615:Cep290 UTSW 10 100,367,012 (GRCm39) missense probably damaging 1.00
R5815:Cep290 UTSW 10 100,393,970 (GRCm39) missense possibly damaging 0.80
R5883:Cep290 UTSW 10 100,359,261 (GRCm39) missense probably benign 0.44
R5889:Cep290 UTSW 10 100,334,936 (GRCm39) missense possibly damaging 0.95
R5928:Cep290 UTSW 10 100,387,692 (GRCm39) missense probably damaging 0.99
R5992:Cep290 UTSW 10 100,379,183 (GRCm39) missense possibly damaging 0.73
R6000:Cep290 UTSW 10 100,377,649 (GRCm39) missense probably damaging 1.00
R6213:Cep290 UTSW 10 100,359,222 (GRCm39) missense probably benign 0.06
R6285:Cep290 UTSW 10 100,359,191 (GRCm39) missense probably benign 0.17
R6306:Cep290 UTSW 10 100,367,028 (GRCm39) missense possibly damaging 0.89
R6593:Cep290 UTSW 10 100,344,638 (GRCm39) missense probably benign 0.01
R6649:Cep290 UTSW 10 100,354,393 (GRCm39) missense probably benign 0.28
R6692:Cep290 UTSW 10 100,405,006 (GRCm39) splice site probably null
R6788:Cep290 UTSW 10 100,324,490 (GRCm39) missense probably damaging 1.00
R6847:Cep290 UTSW 10 100,399,281 (GRCm39) missense probably damaging 1.00
R6947:Cep290 UTSW 10 100,365,918 (GRCm39) missense probably damaging 1.00
R7035:Cep290 UTSW 10 100,334,933 (GRCm39) missense probably benign 0.07
R7073:Cep290 UTSW 10 100,374,865 (GRCm39) missense possibly damaging 0.90
R7114:Cep290 UTSW 10 100,379,220 (GRCm39) missense probably damaging 0.98
R7256:Cep290 UTSW 10 100,382,360 (GRCm39) missense probably damaging 1.00
R7258:Cep290 UTSW 10 100,334,970 (GRCm39) missense probably benign 0.01
R7311:Cep290 UTSW 10 100,373,580 (GRCm39) missense probably damaging 0.98
R7505:Cep290 UTSW 10 100,352,127 (GRCm39) missense probably benign 0.01
R7615:Cep290 UTSW 10 100,328,543 (GRCm39) missense probably benign 0.03
R7643:Cep290 UTSW 10 100,373,415 (GRCm39) missense probably benign
R7662:Cep290 UTSW 10 100,373,665 (GRCm39) missense probably benign 0.21
R7663:Cep290 UTSW 10 100,390,398 (GRCm39) critical splice donor site probably null
R7685:Cep290 UTSW 10 100,375,919 (GRCm39) missense probably benign 0.19
R7699:Cep290 UTSW 10 100,376,231 (GRCm39) missense probably benign 0.33
R7717:Cep290 UTSW 10 100,328,543 (GRCm39) missense probably benign 0.03
R7747:Cep290 UTSW 10 100,394,038 (GRCm39) nonsense probably null
R7757:Cep290 UTSW 10 100,399,296 (GRCm39) missense probably benign
R7843:Cep290 UTSW 10 100,352,050 (GRCm39) missense possibly damaging 0.49
R7905:Cep290 UTSW 10 100,390,352 (GRCm39) missense probably benign
R8078:Cep290 UTSW 10 100,408,749 (GRCm39) missense probably benign 0.04
R8081:Cep290 UTSW 10 100,394,038 (GRCm39) nonsense probably null
R8094:Cep290 UTSW 10 100,380,793 (GRCm39) missense possibly damaging 0.95
R8266:Cep290 UTSW 10 100,395,533 (GRCm39) missense probably benign 0.08
R8305:Cep290 UTSW 10 100,380,796 (GRCm39) missense probably benign 0.09
R8325:Cep290 UTSW 10 100,353,670 (GRCm39) missense probably benign 0.03
R8372:Cep290 UTSW 10 100,385,203 (GRCm39) missense probably benign 0.00
R8443:Cep290 UTSW 10 100,331,706 (GRCm39) missense possibly damaging 0.80
R8497:Cep290 UTSW 10 100,387,320 (GRCm39) missense probably damaging 1.00
R8778:Cep290 UTSW 10 100,350,374 (GRCm39) nonsense probably null
R8975:Cep290 UTSW 10 100,349,782 (GRCm39) missense possibly damaging 0.54
R9146:Cep290 UTSW 10 100,377,665 (GRCm39) missense probably benign 0.44
R9264:Cep290 UTSW 10 100,333,878 (GRCm39) missense possibly damaging 0.86
R9374:Cep290 UTSW 10 100,372,729 (GRCm39) missense probably damaging 0.98
R9448:Cep290 UTSW 10 100,395,546 (GRCm39) missense probably benign 0.32
R9499:Cep290 UTSW 10 100,372,729 (GRCm39) missense probably damaging 0.98
R9507:Cep290 UTSW 10 100,330,785 (GRCm39) missense possibly damaging 0.81
R9539:Cep290 UTSW 10 100,404,713 (GRCm39) missense probably damaging 1.00
R9547:Cep290 UTSW 10 100,380,841 (GRCm39) missense probably benign 0.00
R9551:Cep290 UTSW 10 100,372,729 (GRCm39) missense probably damaging 0.98
R9657:Cep290 UTSW 10 100,351,003 (GRCm39) missense possibly damaging 0.93
R9731:Cep290 UTSW 10 100,346,404 (GRCm39) missense probably damaging 0.98
R9756:Cep290 UTSW 10 100,352,034 (GRCm39) missense probably damaging 0.97
R9777:Cep290 UTSW 10 100,354,529 (GRCm39) missense probably benign 0.01
Z1176:Cep290 UTSW 10 100,385,236 (GRCm39) critical splice donor site probably benign
Z1177:Cep290 UTSW 10 100,374,859 (GRCm39) missense possibly damaging 0.89
Z1177:Cep290 UTSW 10 100,333,806 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTGCACATAGGAAATGACTCAAAC -3'
(R):5'- AGAATCTGTCTACGGAAACAAGTGC -3'

Sequencing Primer
(F):5'- TGACTCAAACATGGATAAGGCTAAG -3'
(R):5'- GTCTACGGAAACAAGTGCTTTGATG -3'
Posted On 2018-03-15